Meat & Livestock Australia Limited v Cargill, Inc
[2018] FCA 51
•9 February 2018
FEDERAL COURT OF AUSTRALIA
Meat & Livestock Australia Limited v Cargill, Inc [2018] FCA 51
File number: VID 542 of 2016 Judge: BEACH J Date of judgment: 9 February 2018 Catchwords: PATENTS – bovine genome – bovine DNA – single nucleotide polymorphisms – molecular genetics – quantitative genetics – inferring or identifying phenotype from genotype – methods to identify or infer quantitative traits by use of specified and non-specified single nucleotide polymorphisms – selection of number of polymorphisms – selection of number of genes – potential parameteritis – opposition proceedings – appeal from decision of delegate – rehearing de novo – construction – manner of manufacture – lack of novelty – lack of inventive step – lack of clarity – lack of utility – lack of sufficiency – definition of invention – lack of fair basis – appeal upheld in part Legislation: Patents Act 1990 (Cth) ss 7(2), 7(3), 18, 40(2), 40(3)
Statute of Monopolies 1624, 21 Jac 1 c 3, s 6
Cases cited: Advanced Building Systems Pty Ltd v Ramset Fasteners(Aust) Pty Ltd (1998) 194 CLR 171
Aktiebolaget Hässlev Alphapharm Pty Ltd (1999) 44 IPR 593; [1999] FCA 628
Aktiebolaget Hässle v Alphapharm Pty Ltd (2002) 212 CLR 411
Apotex Pty Ltd v AstraZeneca AB (No 4) (2013) 100 IPR 285; [2013] FCA 162
Apotex Pty Ltd v Sanofi-Aventis (2008) 78 IPR 485; [2008] FCA 1194
Apotex Pty Ltd v Sanofi-Aventis Australia Pty Ltd (2013) 253 CLR 284
Apotex Pty Ltd v Warner-Lambert Company LLC (No 2) (2016) 122 IPR 17; [2016] FCA 1238
Ariosa Diagnostics Inc. v Sequenom, Inc. 788 F3d 1371 (3d Cir 2015)
Artcraft Urban Group Pty Ltd v Streetworx Pty Ltd (2016) 245 FCR 485
Aspirating IP Ltd v Vision Systems Ltd (2010) 88 IPR 52; [2010] FCA 1061
AstraZeneca AB v Apotex Pty Ltd (2014) 226 FCR 324
AstraZeneca AB v Apotex Pty Ltd (2015) 257 CLR 356
Austal Ships Pty Ltd v Stena Rederi Aktiebolag (2005) 66 IPR 420; [2005] FCA 805
BlueScope Steel Limited v Dongkuk Steel Mill Co., Ltd [2017] FCA 1537
Bristol-Myers Squibb Co v FH Faulding & Co Ltd (2000) 97 FCR 524
British Acoustic Films Ld v Nettlefold Productions (1936) 53 RPC 221
CCOM Pty Ltd v Jiejing Pty Ltd (1994) 51 FCR 260
Commissioner of Patents v Microcell Ltd (1959) 102 CLR 232
Commissioner of Patents v RPL Central Pty Ltd (2015) 238 FCR 27
Commissioner of Patents v Sherman (2008) 172 FCR 394
D’Arcy v Myriad Genetics Inc (2015) 258 CLR 334
DSI Australia (Holdings) Pty Ltd v Garford Pty Ltd (2013) 100 IPR 19; [2013] FCA 132
Electric & Musical Industries Ld v Lissen Ld (1939) 56 RPC 23
F Hoffman-La Roche AG v New England Biolabs Inc (2000) 99 FCR 56
Flexible Steel Lacing Co v Beltreco Ltd (2000) 49 IPR 331; [2000] FCA 890
General Tire & Rubber Co v The Firestone Tyre & Rubber Co Ltd (1971) 1A IPR 121
Genetics Institute Inc v Kirin-Amgen Inc (1999) 92 FCR 106
Gilead Sciences Pty Ltd v Idenix Pharmaceuticals LLC (2016) 117 IPR 252; [2016] FCA 169
GlaxoSmithKline Consumer Healthcare Investments (Ireland) (No 2) Ltd v Apotex Pty Ltd (2016) 119 IPR 1; [2016] FCA 608
Grant v Commissioner of Patents (2006) 154 FCR 62
H Lundbeck A/S v Alphapharm Pty Ltd (2009) 177 FCR 151
Idenix Pharmaceuticals LLC v Gilead Sciences Pty Ltd [2017] FCAFC 196
In the matter of Klaber’s Patent (1906) 23 RPC 461
Kauzal v Lee (1936) 58 CLR 670
KD Kanopy Australasia Pty Ltd v Insta Image Pty Ltd (2007) 71 IPR 615; [2007] FCA 481
Kimberly-ClarkAustralia Pty Ltd v Arico Trading International Pty Ltd (2001) 207 CLR 1
Kirin-Amgen Inc v Hoechst Marion Roussel Ltd (2004) 64 IPR 444; [2004] UKHL 46
Lane Fox v Kensington and Knightsbridge Electric Lighting Co Ltd [1892] 3 Ch 424
Lockwood Security Products Pty Ltd v Doric Products Pty Ltd (No 1) (2004) 217 CLR 274
Lockwood Security Products Pty Ltd v Doric Products Pty Ltd (No 2) (2007) 235 CLR 173
Mayo Collaborative Services v Prometheus Laboratories, Inc. 566 US 66 (2012)
Meat & Livestock Australia Limited and Dairy Australia Limited v Cargill, Inc. and Branhaven LLC [2016] APO 26
Merck & Co Inc. v Arrow Pharmaceuticals Ltd (2006) 154 FCR 31
Merial Inc v Intervet International BV (No 3) (2017) 122 IPR 128; [2017] FCA 21
Meyers Taylor Pty Ltd v Vicarr Industries Ltd (1977) 137 CLR 228
Minnesota Mining and Manufacturing Co v Beiersdorf (Australia) Ltd (1980) 144 CLR 253
National Research Development Corp v Commissioner of Patents (1959) 102 CLR 252
NV Philips Gloeilampenfabrieken v Mirabella International Pty Ltd (1995) 183 CLR 655
Olin Corporationv Super Cartridge Co Pty Ltd (1977) 180 CLR 236
Olin Mathieson Chemical Corporation v Biorex Laboratories Ltd [1970] RPC 157
Otsuka Pharmaceutical Co Ltd v Generic Health Pty Ltd (No 2) (2016) 120 IPR 431; [2016] FCAFC 111
Otsuka Pharmaceutical Co Ltd v Generic Health Pty Ltd(No 4) (2015) 113 IPR 191; [2015] FCA 634
Palmer v Dunlop Perdriau Rubber Co Ltd (1937) 59 CLR 30
Pharmacia & Upjohn AB (opposition by CSL Limited) [2000] APO 58
Rescare Ltd v Anaesthetic Supplies Pty Ltd (1992) 111 ALR 205; [1992] FCA 811
Sachtler GmbH and Co KG (formerly Sachtler AG) v RE Miller Pty Ltd (2005) 221 ALR 373; [2005] FCA 788
Sanofi-Aventis Australia Pty Ltd v Apotex Pty Ltd (No 3) (2011) 196 FCR 1
Sartas No 1 Pty Ltd v Koukourou & Partners Pty Ltd (1994) 30 IPR 479; [1994] FCA 936
SNF (Australia) Pty Ltd v Ciba Speciality Chemicals Water Treatments Limited (2011) 92 IPR 46; [2011] FCA 452
Tramanco Pty Ltd v BPW Transpec Pty Ltd (2014) 105 IPR 18; [2014] FCAFC 23
Voxson Pty Ltd v Telstra Corporation Ltd (No 7) (2017) 343 ALR 681; [2017] FCA 267
Wellcome Foundation Ltd v VR Laboratories (Aust) Pty Ltd (1981) 148 CLR 262
Williams Advanced Materials, Inc. v Target Technology Company LLC (2004) 63 IPR 645; [2004] FCA 1405
Dates of hearing: 15, 16, 17, 18 and 19 May, 6 and 7 June 2017 Date of last submissions: 10 July 2017 Registry: Victoria Division: General Division National Practice Area: Intellectual Property Sub-area: Patents and associated Statutes Category: Catchwords Number of paragraphs: 949 Counsel for the Appellants: Ms K Howard SC and Mr T Cordiner QC Solicitor for the Appellants: Phillips Ormonde Fitzpatrick Lawyers Counsel for the First Respondent: The First Respondent did not appear and filed a submitting notice Counsel for the Second Respondent: Mr C Dimitriadis SC and Mr BJ Fitzpatrick Solicitor for the Second Respondent: K&L Gates ORDERS
VID 542 of 2016 BETWEEN: MEAT & LIVESTOCK AUSTRALIA LIMITED
(ACN 081 678 364)First Appellant
DAIRY AUSTRALIA LIMITED (ACN 105 227 987)
Second Appellant
AND: CARGILL, INC
First Respondent
BRANHAVEN LLC
Second Respondent
JUDGE:
BEACH J
DATE OF ORDER:
9 February 2018
THE COURT ORDERS THAT:
1.Within 14 days of the date of these orders, each of the parties file and serve proposed minutes of orders and short submissions (limited to three pages) to give effect to these reasons, including on the question of any steps necessary to deal with any application to amend the claims of patent application no. 2010202253 and on the question of costs.
2.Costs reserved.
Note: Entry of orders is dealt with in Rule 39.32 of the Federal Court Rules 2011.
REASONS FOR JUDGMENT
BEACH J:
The first appellant, Meat & Livestock Australia Limited, invests in research relevant to the Australian meat and livestock industry. It was established on 18 February 1998 as a declared industry marketing and research body under the Australian Meat and Live-stock Industry Act 1997 (Cth). The second appellant, Dairy Australia Limited, also an Australian company, invests in research relevant to the Australian dairy industry. For convenience, I will refer to the appellants as MLA.
The first respondent, Cargill, Inc. (Cargill), is a US corporation, one of whose major businesses is the raising of livestock. The second respondent, Branhaven LLC (Branhaven), is also a US corporation. Branhaven and Cargill are co-applicants of Australian patent application number 2010202253 (the 253 Application) titled “Compositions, methods and systems for inferring bovine traits”. The principal claims of the 253 Application involve method claims for identifying a trait of a bovine subject from a nucleic acid sample of that subject. The field of the invention relates generally to gene association analyses, specifically to single nucleotide polymorphisms and correlated traits of bovine species. The scientific disciplines that are relevant are molecular genetics and quantitative genetics, on which I will say a little more later.
The 253 Application was filed on 1 June 2010 as a divisional application of the parent Australian patent application number 2003303599 filed on 31 December 2003, which has now been withdrawn. The parent application claimed a priority date of 31 December 2002 based upon US application number 60/437,482. Accordingly, the co-applicants of the 253 Application assert that the earlier priority date of 31 December 2002 applies.
In proceedings before the Patent Office, MLA opposed the grant of the 253 Application. Subject to one matter, that opposition was unsuccessful before the delegate of the Commissioner of Patents. The proceeding before me is an appeal by MLA from the decision of the delegate made on 6 May 2016; only Branhaven has actively resisted the present appeal. The delegate decided that the opposition brought by MLA failed on all grounds, save for one ground of lack of clarity and an aspect of a “manner of manufacture” concern affecting one claim of the 253 Application (Meat & Livestock Australia Limited and Dairy Australia Limited v Cargill, Inc. and Branhaven LLC [2016] APO 26).
I would note one matter at this point. The 253 Application is to be considered pursuant to the provisions of the Patents Act 1990 (Cth) (the Act) prior to the amendments made by the Intellectual Property Laws Amendment (Raising the Bar) Act 2012 (Cth), as I will explain later. The appeal is pursuant to s 60(4) of the Act, but the amendment concerning s 60(3A) does not apply.
The appeal is a hearing de novo on the grounds advanced and evidence adduced before me (Commissioner of Patents v Sherman (2008) 172 FCR 394 at [18] to [21] per Heerey, Kenny and Middleton JJ). Evidence before the delegate is not able to be adduced before me without leave. Further, as this is a complete re-hearing, findings made by the delegate have little separate status although I am entitled to take them into account (as I have done) given the delegate’s significant technical expertise. In this case, the delegate was Dr Lexie Press, who has worked as a molecular geneticist with the CSIRO and Stanford University prior to joining IP Australia. But I should note that I have not given her findings substantial weight given that most of the expert evidence adduced before me had not been put before her.
The following principles, as synthesised by Moshinsky J in Merial Inc v Intervet International BV (No 3) (2017) 122 IPR 128; [2017] FCA 21 at [11] to [16], apply to the present appeal. First, opposition to the grant of a standard patent may be based on the grounds set out in s 59 of the Act. Second, the opponent bears the relevant onus both before the delegate and before me on appeal to establish the relevant ground(s). Third, for the opponent’s appeal to succeed it must be “clear” or “practically certain” that the patent, if granted, would not be valid; I will discuss any significance attaching to the different formulations in a moment. Fourth, the standard of proof is generally that prescribed by s 140 of the Evidence Act 1995 (Cth), but subject to the threshold that I have just mentioned.
The basis for the requirement that an opponent must show that it is “clear” or “practically certain” that a patent if granted would not be valid was illuminated by Emmett J in F Hoffman-La Roche AG v New England Biolabs Inc (2000) 99 FCR 56, following Genetics Institute Inc v Kirin-Amgen Inc (1999) 92 FCR 106 at [17] to [21]. Because there are two stages post acceptance at which validity might be challenged, namely, pre-grant opposition proceedings and post-grant revocation proceedings, there is a distinction between the two proceedings. As his Honour said, this is “consistent with the proposition that pre-grant opposition is intended to provide a relatively inexpensive mechanism for resolving third party disputes as to validity” and that “[t]he purpose of pre-grant opposition proceedings is to provide a swift and economical means of settling disputes that would otherwise need to be dealt with by the courts in more expensive and time consuming post-grant litigation” (at [47] and see also [66]).
In determining whether a ground of opposition was made out on appeal, his Honour adopted the test that it “should appear clear to the Court that no patent granted in respect of the specification would be valid”, and accepted in this respect that where the proposed patent was tricky the opponent may be entitled to adduce evidence of considerable complexity to establish to the requisite degree that such a patent would, if granted, be invalid. So his Honour said at [67]:
The language employed in the cases to which I have referred suggests that it should appear clear to the Court that no patent granted in respect of the specification would be valid. I consider that, before the Court would uphold an opposition to the grant of a patent, the Court should be clearly satisfied that the patent, if granted, would not be valid. That, however, is not to say that an opponent should not be permitted appropriate opportunity to lead evidence-in-chief as to the facts that are designed to demonstrate, with the requisite degree of clarity, that a patent, if granted, would not be valid. Where the subject matter of the patent is one of complexity, of necessity, the evidence that an opponent would be entitled to adduce would itself be of considerable complexity.
Further, in Austal Ships Pty Ltd v Stena Rederi Aktiebolag (2005) 66 IPR 420; [2005] FCA 805, Bennett J considered such principles in pre-grant opposition proceedings in the context of expert opinion evidence directed to the ultimate question of whether an asserted ground of opposition had been made out. Her Honour said (at [12]):
I can accept that a lower standard may apply to proof of evidence such as whether a document has been published or, indeed, whether a prior art vessel was well-known. I do not accept that it properly applies to the factual question that itself is the test for obviousness or lack of inventive step. Where the factual question is itself the legal test, as set out in s 7(3) of the Act, it seems to me that it should be determined at the higher standard. That means that where there are two opposing expert views that are conclusive on obviousness, both presented bona fide by witnesses of accepted expertise, unless one set of views can be rejected on proper grounds, the legal burden to establish a ground of opposition is not discharged; the court cannot be practically certain that obviousness or lack of inventive step is established.
Now there seems to be some difference in the authorities concerning the formulation of the relevant test. Some authorities use the language of “practically certain”, whilst other authorities use the language of “appears clear” or “clearly satisfied” that the patent, if granted, would be invalid. It has been suggested that the varying phraseology is to similar effect (Aspirating IP Ltd v Vision Systems Ltd (2010) 88 IPR 52; [2010] FCA 1061 at [33] per Besanko J) although I am not so convinced; there is something to be said for justifying the historical use of the former phrase in the earlier acceptance phase only, which is ex parte, rather than in the later opposition phase, which is inter partes. In any event, for my part I prefer the phraseology of Emmett J. But I have also adopted the approach of Bennett J in Austal Ships at [12] that where there are conflicting sets of expert opinions on an issue such as a lack of inventive step presented bona fide by witnesses of accepted expertise, then unless one set of views can be rejected on proper grounds, the legal burden on the opponent to establish to the requisite degree the relevant ground of opposition will not be discharged. In such a scenario, I could not be clearly satisfied that the ground of opposition had been made out. But notwithstanding these observations, I accept for present purposes that primary facts (as distinct from secondary conclusions or the ultimate ground of opposition question) that are relevant to and that are said to support any ground of opposition need only be established by the opponent on the balance of probabilities.
In summary, I have rejected MLA’s principal grounds of opposition and its corresponding grounds of appeal.
First, MLA’s central attack that the claims do not satisfy the “manner of manufacture” requirement fails. D’Arcy v Myriad Genetics Inc (2015) 258 CLR 334 is distinguishable, save for one claim to a particular isolated polynucleotide out of the 15 claims. But to demonstrate this I will need to discuss that case in more detail than is usual. The conclusion is clear, but the analysis is not without its complexity. I should note that my case, except in one minor aspect, does not concern whether product claims to nucleic acid molecules per se are patentable, even if isolated from their natural environment and artificially created in a chemical sense or, as so isolated, having different actual or potential chemical properties to the naturally occurring nucleic acid in its natural environment. The case that I have to resolve principally concerns method claims. Further, the case that I have to resolve does not just concern looking at a claim in relation to a nucleic acid molecule and considering whether one should, in the context of such a claim, characterise the invention in terms of its chemical structure and properties on the one hand or its genetic informational content on the other hand. Further, the case that I have to resolve does not just deal with claims that involve the discovery of an objectively observed statistically significant correlation between genotype and phenotype. In the context of the claims that I have to consider, that is only the starting point for the analysis rather than the finishing point to determining patentability.
Second, MLA’s other significant attacks, namely, a lack of novelty and lack of inventive step go nowhere close to satisfying the threshold MLA must demonstrate on this appeal given the genuine and substantial conflict in the expert opinion evidence.
Third, MLA has also advanced arguments concerning lack of utility, lack of sufficiency and lack of fair basis which I have also rejected, save as to an aspect of lack of utility which relates to two of my findings on construction. But contrastingly, MLA has had some success on some questions of construction and associated grounds dealing with lack of clarity and lack of definition. Several integers of the relevant claim(s) will need to be amended to deal with questions of linkage disequilibrium between relevant single nucleotide polymorphisms and also to address questions of statistical significance. And if appropriate amendments are made, then the conclusions of lack of clarity, lack of definition and the residual aspect of lack of utility that I have reservations about fall away.
It is convenient to divide the balance of my reasons into the following sections:
(a)Some scientific principles – [18] to [145];
(b)The 253 Application – [146] to [175];
(c)The steps of the claimed invention – [176] to [212];
(d)Construction of the claims – [213] to [385];
(e)Manner of manufacture – [386] to [516];
(f)Lack of novelty – [517] to [677];
(g)Lack of inventive step – [678] to [819];
(h)Lack of utility – [820] to [882];
(i)Lack of sufficiency – [883] to [914];
(j)Lack of fair basis – [915] to [931];
(k)Lack of clarity and definition – [932] to [946]; and
(l)Conclusion – [947] to [949].
The length of what follows is in part a reflection of the notable sophistication with which Ms Katrina Howard SC and Mr Tom Cordiner QC for MLA, and Mr Christian Dimitriadis SC and Mr Benjamin Fitzpatrick for Branhaven, have presented their cases.
SOME SCIENTIFIC PRINCIPLES
Let me begin with a summary of some of the non-controversial scientific principles that will inform my later discussion. The summary has been drawn from the expert evidence including aspects of the technical summary provided by MLA to the extent that it accords with the evidence. The summary reflects common general knowledge as at the priority date of the relevant person skilled in the applicable art, unless I indicate otherwise.
(a) Glossary of key terms
To facilitate comprehension, the following glossary of key terms is necessary, although I will elaborate on some of the concepts in more detail later:
·Allele
An allele is one of two or more alternative forms of the same gene or same genetic locus. An individual inherits two alleles for each gene, one from each parent. If the two alleles are the same, the individual is homozygous for that gene/loci. If the alleles are different, the individual is heterozygous as represented in the following diagram:
·Chromosome
A coiled three dimensional structure of double helix DNA, coiled around support and scaffold proteins and containing many genes.
·Codon
A codon is a trinucleotide sequence of DNA bases (A, C, G and T) which encode for a specific amino acid. There are 64 different codons. 61 codons specify for amino acids (although sometimes for the same amino acid), while the remaining three codons are used as stop signals.
·Contig
A contig (short for contiguous) is a reference to overlapping DNA sequences.
·DNA
Deoxyribonucleic acid (DNA) is the molecular code of inheritance. The DNA sequence is the arrangement of the 4 letters (representing DNA bases) of the genetic code into information.
·Epistasis
The interaction between different genes (as opposed to different alleles) including suppression or inhibition of the phenotypic expression of one gene by the second non-allelic gene (gene at a different locus).
·Exon
An exon is that portion of a gene that codes for amino acids. In mammals, most gene sequences are broken up by one or more DNA sequences called introns. The parts of the gene sequence that are expressed as a protein(s) are called exons.
·Gamete
A germ cell (egg cell or sperm cell) that is typically, and for present purposes is, haploid.
·Gene
Generally, this is the basic unit of heredity in organisms. It consists of a sequence of DNA in mammals coding ultimately for a protein. Proteins work together to contribute to traits. I will return to the definition of “gene” later and whether it includes not only exons but also introns and other regulatory but non-coding sequences. The definition of “gene” is one of the issues between the parties relating to the construction of claim 1 of the 253 Application.
·Genetic marker
A genetic marker is a DNA sequence with a known physical location on a chromosome.
·Genome
The genome is the entire set of genetic instructions found in a cell. The genome consists of pairs of chromosomes.
·Genomic selection (GS)
I have explained the parameters of genomic selection (GS) in sub-section (f) below, which I have described as approach 5.
·Genome wide association study (GWAS)
I have explained the parameters of a genome wide association study (GWAS) in sub-section (f) below, which I have described as approach 6.
·Genotype
A genotype is an individual’s collection of genes. But the term can also refer to the two alleles inherited for a particular gene.
·Haploid
A single set of unpaired chromosomes.
·Haplotype
A collection of specific alleles, DNA variations, or polymorphisms, which tend to be inherited together due to their proximity to each other. For example, there are two simple haplotypes present in the diagram set out above in the discussion of an allele: PY and pY.
·Homologous recombination
Homologous recombination is a type of genetic recombination that occurs during meiosis (the formation of egg and sperm cells). Paired chromosomes from the male and female parent align so that similar DNA sequences from the paired chromosomes cross over each other. Crossing over results in a shuffling of genetic material and is an important cause of the genetic variation seen among offspring.
·Intron
An intron is a portion of a gene (a proposition that I will justify later) that does not code for amino acids. In mammals, most gene sequences include one or more introns.
·Karyotype
The number and appearance of chromosomes in the cell nuclei of, say, a mammal.
·Linkage
Linkage is the close association of genes or DNA markers on the same chromosome. The closer two genes/markers are to each other, the greater the probability that they will be inherited together.
·Linkage disequilibrium (LD)
The concept of linkage disequilibrium (LD) is used in population genetics to describe a non-random association of alleles at two or more loci on the same chromosome reflecting haplotypes descended from a single ancestral chromosome. It is a measure of whether an allele at one locus tends to be found more often with an allele at another locus. It is a measure of combinations of alleles or genetic markers in a population that are more frequently found to be inherited together than would be expected from the random formation of haplotypes. The further apart two alleles or markers are, the less likely that they are to be “linked”.
·Locus/Loci
A locus is the specific physical location of a gene or DNA marker on a chromosome. The plural of locus is “loci”. A variant of a similar DNA sequence located at a locus is called an allele.
·Marker assisted selection
Use of genetic markers in methods that allows for selection of animals with desired genotypes.
·Microsatellite
Microsatellite sequences are repetitive DNA sequences that are usually several base pairs in length (e.g. GCGCGCGCGC). They are used as genetic markers to follow the inheritance of genes. They are sometimes referred to as short tandem repeats. When microsatellite sequences are replicated, the repetitive nature of the sequence means that the copying mechanisms can make errors in the copy, typically by adding (in this example) an additional GC. The number of times that the unit is repeated in a given microsatellite can be highly variable, a characteristic that makes them useful as genetic markers. Microsatellites are markers suitable for QTL mapping. Sometimes an alternative description is given for microsatellites, being what are known as polymorphic repeat sequences. Microsatellites mainly occur in non-coding sequences, usually a 2 to 5 nucleotide repeating sequence e.g. GCGCGCGCGC, where the repeating unit is present in different numbers (5 GC repeats in this example).
·Non-coding DNA
Non-coding DNA sequences do not code for amino acids. Most non-coding DNA lies between genes on a chromosome. Other non-coding DNA, called introns, is found within genes (on the definition of “gene” which I have accepted). Some non-coding DNA plays a role in the regulation of gene expression; whether such DNA is part of a “gene” is a matter for debate.
·Phenotype
A phenotype is an individual’s observable physical characteristics or traits, whether generally or for a particular trait, that can vary from animal to animal. The genetic contribution to the phenotype can sometimes be referred to as the genotype.
·Pleiotropic
The effect of an allele on multiple traits.
·Polymorphism
A polymorphism involves one of two or more variants of a particular DNA sequence. The most common type of polymorphism involves variation at a single base pair, called a single nucleotide polymorphism or SNP. But polymorphisms can also be much larger in size and involve long stretches of DNA.
·Qualitative trait
A qualitative trait is one in which a clear distinction between the presence of the trait, or the absence of the trait, can be determined (i.e. for cattle, horned or polled (no horns)).
·Quantitative trait
A quantitative trait is one that can vary continuously from animal to animal. Quantitative traits can be attributed to one gene, but they are usually the result of the activity of a combination of genes on different chromosomes. In other words, a quantitative trait can be the sum effect attributable to two or more genes. Indeed, a large number of genes may each make a small contribution to the overall trait. Alternatively, a small number of genes may make a large contribution to the overall trait.
·Quantitative trait locus (QTL)
Quantitative trait loci (QTLs) are stretches of DNA containing or linked to particular genes that correlate with a continuously variable trait. “Linked” means “associated with, or attributable to”.
·Shotgun sequencing
Shotgun sequencing is a laboratory technique for determining the DNA sequence of an organism’s genome. The method involves breaking the genome into a collection of small DNA fragments that are sequenced individually. A computer program looks for overlaps in the DNA sequences and uses them to place the individual fragments in their correct order to reconstitute the genome.
·Single nucleotide polymorphism (SNP)
As I have already touched on, single nucleotide polymorphisms (SNPs) are a type of polymorphism involving variation of a single base pair at specific loci. It is a DNA sequence variation in which a single nucleotide differs between members of a biological species or differs in the one member as between paired chromosomes. SNPs can act as biological markers to locate genes that are associated with disease or other traits of interest. When SNPs occur within a coding region of a gene or in a regulatory region for a gene, they may play a more direct role in the relevant trait by affecting the gene’s function.
·SNP chip/SNP array
A SNP array is a solid substrate, typically glass, containing a specific series of short nucleic acid sequences immobilized at known locations. The array includes pairs of sequences, varying by a specific SNP. Sample DNA is incubated with the array to allow binding to the array. Probes are used to detect binding between the sample DNA and the DNA immobilized on the array, with binding or non-binding at a specific location on the array indicating the presence or absence (as the case may be) of a specific SNP in the sample DNA.
In order to explain the relativity of some of these concepts, the following analogy provided by Professor Graham Plastow (an expert called by Branhaven) should be of assistance:
The genome the entire world
A chromosome a country in the world
QTL a state within the country
A gene a city within the state
A SNP a street address in that state
(b) The genetic code
DNA
Genetic information is stored in the form of DNA. DNA consists of four different nucleotides, each consisting of an identical pentose sugar group (the sugar backbone), an identical phosphate group and one of four nitrogenous bases (adenine: A; guanine: G; thymine: T; and cytosine: C). The DNA sequence is the arrangement of unique combinations of these four bases.
DNA exists in the form of a double helix (see Figure 1 below) comprising two complementary strands which are bound together via hydrogen bonding between specific complementary (base paired) nucleotides (A bonds with T and C bonds with G). As such, each strand provides a complementary template of the other strand.
Figure 1 – Double helix structure of DNA
The standard format for writing and reading a DNA sequence is to list the “coding” strand in a 5’ (five prime) to 3’ (three prime) direction. The terminology 5’ and 3’ relates to the carbon numbers in the sugar backbone of nucleic acids, with a hydroxyl group on the third carbon of the sugar backbone of one nucleic acid bonding with a phosphate group on the fifth carbon of the sugar backbone of the subsequent nucleic acid (see Figure 2 below). This gives DNA conceptual directionality when synthesised and read.
Figure 2 – Directionality of nucleic acids in DNA
Consequently, and for example, a DNA sequence such as ATGGCGTGTGACGAAATAGGG denotes the coding strand (5’-ATGGCGTGTGACGAAATAGGG-3’), which when read from left to right can provide the code for the relevant amino acid(s) and ultimately the relevant protein. However, as DNA is a double stranded molecule, each coding sequence has a complementary strand, with each nucleotide in one strand being bound to its complementary nucleotide on the complementary strand (see Figure 3 below). This complementary strand can be written in a 5’ to 3’ direction. For example, the complement of the above sequence when written 5’ to 3’ (known as the reverse complement) is 5’-CCCTATTTCGTCACACGCCAT-3’. However, usually only the coding strand is written.
Figure 3 – Complementary DNA sequences
Genetic code
DNA stores genetic information and can be duplicated to permit the genetic information to be passed on to daughter cells, via a process known as mitosis. Specific portions of DNA (genes) are “read” by molecular structures in the cell and are converted (through the process of transcription) into another form of polynucleotide called ribonucleic acid (RNA).
Codons
To allow four nucleotides to encode for twenty different amino acids, DNA is “read” in blocks of three sequential nucleotides known as a “codons”. For example, ATGGCGTGTGATGAAATAGGG, can be read as ATG-GCG-TGT-GAT-GAA-ATA-GGG. Each codon codes for an amino acid.
As can be seen in the Table below, each amino acid (with the exception of Methionine and Tryptophan) is encoded by more than one codon.
Amino Acid Single letter abbreviation Three letter abbreviation Codon Alanine A Ala GCT, GCC, GCA, GCG Cysteine C Cys TGT, TGC Aspartic acid D Asp GAT, GAC Glutamic acid E Glu GAA, GAG Phenylalanine F Phe TTT, TTC Glycine G Gly GGT, GGC, GGA, GGG Histidine H His CAT, CAC Isoleucine I Ile ATT, ATC, ATA Lysine K Lys AAA, AAG Leucine L Leu TTA, TTG, CTT, CTC, CTA, CTG Methionine M Met ATG Asparagine N Asn AAT, AAC Proline P Pro CCT, CCC, CCA, CCG Glutamine Q Gln CAA, CAG Arginine R Arg CGT, CGC, CGA, CGG, AGA, AGG Serine S Ser TCT, TCC, TCA, TCG, AGT, AGC Threonine T Thr ACT, ACC, ACA, ACG Valine V Val GTT, GTC, GTA, GTG Tryptophan W Trp TGG Tyrosine Y Tyr TAT, TAC Stop codon
-
Term
TAA, TAG, TGA
Start codon
The codon for methionine (ATG) is referred to as the “start codon” as methionine is the first amino acid in the proteins of all eukaryotic cells (i.e. a cell with a nucleus containing the chromosomes). Therefore, ATG when read in the correct open reading frame will signify the start of a protein coding region in a gene.
Stop codon
As can be seen from the above Table, three codons (TAA, TAG and TGA) are referred to as “stop codons”. These stop codons function to indicate the end of a protein encoding region of DNA. The redundancy in DNA sequences and the presence of stop codons are important elements when considering how genetic variation can influence protein structure and function.
Genes
A gene, the definition of which I will discuss later, can be considered to include a span of DNA that ultimately encodes for a protein. The process by which a cell produces a protein from a gene is referred to as gene expression and invariably includes a messenger ribonucleic acid (mRNA) intermediate. The DNA is transcribed into mRNA through several steps that I will describe in a moment. The mRNA is then translated, ultimately, into a protein(s). Each codon is read with the corresponding amino acid formed. Chains of amino acids are formed with peptide bonds between each amino acid. The polypeptide so formed is the protein. For a further uncontroversial discussion of amino acids, peptide bonds and polypeptides, see Idenix Pharmaceuticals LLC v Gilead Sciences Pty Ltd [2017] FCAFC 196 at [50] to [53] per Nicholas, Beach and Burley JJ.
The transcription initiation site is generally determined by specific regions which are upstream (5’) of the transcription initiation site. The expression UTR refers to either of two untranslated regions either side of the coding sequence. The upstream regions are known as “promotor sites” and usually are defined by highly conserved regions of DNA that serve as binding sites for transcription factors which facilitate or activate transcription of DNA to RNA. Generally, there are three consensus sequences (sequences with similar structures) upstream of the transcription initiation site (position 0). The first of these is the TATA box (TATAAAA) which is found approximately 25 nucleotides upstream (position -25) of the transcription initiation site. The second of these is the CAAT box (GGCCAATCC) approximately 75 nucleotides upstream of the initiation site. The third of these is the GC box (GGGCGG) approximately 90 nucleotides upstream of the transcription initiation site (see Figure 4 below). Transcription continues beyond the translation termination site as shown below, and the generated RNA is then later cleaved.
Figure 4 – Simple gene structure including UTRs
Exons and introns
A gene, on the generally accepted view of what constitutes a “gene” that I will discuss in more detail later, also includes sections that are transcribed into RNA but are then excised before the resulting mRNA is translated into a protein (see Figure 5 below). These sequences that are excised are called introns, and do not contribute to coding for the amino acid sequence leading to the protein. The sections of the DNA that ultimately code for the protein are located within regions called exons.
Figure 5 – Transcription of DNA to mRNA
In general, exons only account for about 4% to 5% of the nucleotides that are transcribed. Furthermore, there are considerable spans of DNA, known as intergenic DNA, that sit between transcribed regions and which do not encode for RNA or proteins. As such there is only a relatively small portion of DNA in mammals that actually encodes for proteins.
Nevertheless these vast non-coding (intergenic and intronic) regions have important biochemical and biological functions. Portions of these non-coding regions play a critical role in regulation of the coding regions and can determine how much, or how little, mRNA (and consequently protein) is produced. In some instances, these regulatory regions act as binding sites for regulatory elements. Binding of these regulatory elements to the DNA influences the rate of transcription of the coding DNA into mRNA. Furthermore, non-coding DNA can have important structural properties that may play a role in chromosome structure, the function of centromeres (the central portion of a chromosome), the process of mitosis (cell division) and the process of meiosis (generation of gametes).
Due to the importance of non-coding DNA, especially the DNA in close proximity to coding DNA, on one view the term “gene” can also include the promoter and enhancer regions as well as the DNA regions in between these regions and the transcribed DNA. I will return to the construction question concerning “gene” later in my reasons.
Before proceeding further I should also note that in relation to the statements in the preceding three paragraphs, there is a debate between the parties as to whether such matters (or part thereof) were part of common general knowledge as at the priority date.
Chromosomes
In eukaryotic cells, genetic information is stored in coiled and condensed structures called chromosomes. Each chromosome consists of a complex three-dimensional structure of double helix DNA, which has been coiled around support and scaffold proteins, to form a condensed cluster of DNA.
Many genes can be physically clustered together on a single chromosome (indicated by the dark band in Figure 6 below). Depending upon their proximity to one another, they may have a propensity to be inherited together.
The structure of a chromosome varies depending on the stage of the cell cycle. Typically, a chromosome is a single supercoiled length of DNA which has a spindle of fibres in the middle called the centromere (see Figure 6(a) below). But in the later stage of the cell cycle, the chromosome is duplicated, to form two copies of the chromosome, which are connected at the centromere. In this form, each copy is referred to as a chromatid (see Figure 6(b) below). Each chromatid is then separated during duplication of the cell and provides the genetic information for one of the two cells (the original parent cell and the daughter cell).
Figure 6 – Chromosome structure
(a) (b)
Chromosomes exist in pairs. A mammal inherits two copies of each chromosome, one from their mother and one from their father. The notable exception to this are the sex chromosomes in males, whereby a male has one X chromosome (inherited from his mother) and one Y chromosome (inherited from his father). In cattle there are thirty pairs of chromosomes (sixty chromosomes in total – see Figure 7 below).
Figure 7 – Bovine karyotype
Mutations and alleles
During cell replication, DNA is duplicated so that a copy of the genetic code can be incorporated into a daughter cell. During this process, double stranded DNA is separated, and each strand is used as a template to produce a second complementary strand. Cells have extensive proof-reading and error-checking abilities. Consequently, DNA is generally replicated, and passed onto the daughter cell, unchanged. However, despite this stringency, changes in the DNA sequence, known as mutations, can occur. Mutations can be caused by errors in the replication of DNA known as copy errors. Another cause of errors is exposure to external influences, for example exposure to chemicals, free radicals or radiation.
Gene mutations can be classified into either acquired (somatic) mutations or hereditary (germline) mutations.
Somatic mutations are mutations that only appear in a specific cell(s) during an animal’s life, and are then reproduced in the daughter cells from that specific cell during replication. Consequently, these mutations only exist in a subset of cells within an animal. The mutations that lead to cancer are examples of somatic mutations.
Contrastingly, germline mutations are mutations that are either formed in the fertilised egg shortly after fertilisation, or formed in the gametes (egg or spermatozoa) of the parents (in the same way described above for somatic mutations). Germline mutations will be present in every cell of the animal’s body. Accordingly, they may be present in the gametes that the animal produces and hence in his or her offspring.
Differences between individuals in DNA sequence are in part due to mutations that have occurred in their ancestors. These mutations provide the basis for genetic diversity within populations, and account for a significant portion of the differences in the physiology of individuals within a given population. Moreover, combinations of mutations are specific to an individual, and are useful in population studies to identify genetic differences between individuals, and assess how those differences may influence the physiology of that individual.
Types of mutations
The simplest form of mutation is called a point mutation. This type of mutation arises when a single nucleotide is substituted by another single nucleotide (e.g. a T mutates to a C). An individual carrying this mutation may pass it on to many descendants so that both the original form (T) and the mutated form (C) exist in the population. When a nucleotide at the same location (locus) in the genome varies amongst individuals, this is called a single nucleotide polymorphism (SNP or pronounced “snip”) (see the red boxes in Figure 8 below). SNPs can be identified by extracting a sample of DNA from individuals, sequencing it and then comparing the homologous sequence from several individuals within the same species.
Figure 8 – Identification of SNPs
A SNP in that part of the DNA that codes for amino acids within a protein (a coding SNP) can be classified as one of the following three types:
(a)First, there is a type known as a “synonymous mutation”. A synonymous mutation occurs when the SNP does not result in a change in protein sequence (i.e. the mutated codon still encodes for the same amino acid). For example the sequence for individual 1 in Figure 8 above (assuming it is an in-frame coding region) will be read as ATG:GCG:TGT:GAC:GAA:ATA:GGG and will encode for the amino acid sequence Met, Ala,
Cys, Asp, Glu, Ile, and Gly. Likewise, the sequence for individual 2 (ATG:GCG:TGC:GAC:GAA:ATA:GGG), which has a T/C mutation at position 9, will encode for the same amino acid sequence. This is due to the third codon of individual 2, spanning from position 7 to 9 (TGC), and the third codon of individual 1 (TGT), both encoding for the same amino acid, Cysteine (Cys). Consequently, despite a mutation in the DNA the resultant protein has not changed. As such it is likely that this mutation will have no or very little functional consequence on the animal.
(b)Second, there is a type known as a “missense mutation”. Contrastingly to a synonymous mutation, a missense mutation occurs when a SNP occurs inside of a coding region and results in a change in the protein sequence (i.e. the mutated codon encodes for a different amino acid). With reference to the sequences illustrated in Figure 8 above, the sequence for individual 3 (having a G/C mutation at position 19) would result in the last codon being CGG (instead of GGG for individuals 1, 2 and 4). The consequence of this is that the codon for individual 3 (CGG) encodes for Arginine, while the codon for individuals 1, 2 and 4 (GGG) encodes for Glycine. This change in amino acid sequence may change the function of the protein.
(c)Third, there is a type described as a “nonsense mutation”. A nonsense mutation occurs when a SNP occurs inside of a coding (exonic) region and results in a premature stop codon. As I have already indicated, three codons (TAA, TAG, TGA) encode for stop codons which signal the termination of translation of mRNA into a protein. As such, the premature introduction of a stop codon leads to a truncated protein, which potentially may have significantly reduced or no function. With reference to the sequences illustrated in Figure 8 above, the sequence for individual 4 (having a G/T mutation at position 13) would result in the fifth codon (spanning positions 13 to 15) being TAA (instead of GAA as per individuals 1 to 3). The consequence of this is that the codon for individual 4 (TAA) encodes a stop codon, while the codon for individuals 1 to 3 (GAA) encodes Glutamic acid. This change will result in the protein translated from the mRNA sequence of individual 4 to be prematurely stopped after four amino acids (Met, Ala, Cys, Asp, instead of Met, Ala, Cys, Asp, Glu, Ile, and Gly).
So far I have discussed coding SNPs. Let me turn to other types of SNPs. SNPs that occur outside the coding DNA are called non-coding SNPs and may have an effect on the regulation of a gene, for example, by altering the binding of a regulatory molecule to the DNA.
More generally, let me now turn to some other types of mutations being insertions/deletions, duplications and repeat expansion.
Insertion and deletion mutations occur when nucleotides are introduced or removed from a DNA sequence. Collectively these are known as “indels”. These indels can be as small as one nucleotide change or as large as 10,000 nucleotides. They can be even larger on a chromosomal level. Like SNPs, these indels can occur in coding or non-coding regions and their consequence will vary depending on their location as follows:
(a)If the indel is in an exon and its length is 3, 6, 9 … nucleotides (i.e. a multiple of 3), it will add or delete a number of amino acids to the protein.
(b)If the indel is in an exon and its length is not a multiple of 3 nucleotides, it will lead to a frame shift. This will generally result in significant alterations to the structure of the subsequently produced protein. As I have said, DNA sequences are read as groups of three nucleotides (codons). Consequently, if an indel is not a multiple of 3 nucleotides, then the amino acids encoded after the mutation are generally altered.
(c)An illustration of an insertion mutation is provided in Figure 9 below. As can be seen in Figure 9(a), a guanine (G) has been inserted after position 3 of the sequence for individual 2. Consequently, the nucleotides after the insertion are displaced one position and the codons after the insertion have been changed (as shown in Figure 9(b)) for individual 2. The insertion of a guanine results in a premature stop codon at codon number 4 (positions 10 to 12) for individual 2. This is typical of what happens when there is an insertion or deletion of nucleotides in a coding sequence, except for when nucleotides are inserted in multiples of 3. But when the indel is outside of the coding region, it is less likely that the indel will have a functional effect, although it may alter gene regulation.
Figure 9 – Insertion mutation
(a)
(b)
A duplication mutation consists of a piece of DNA that is abnormally copied one or more times. The duplication may be as small as two nucleotides, or it may involve the duplication of large chunks of DNA (10,000s – 100,000s nucleotides).
As for repeat expansion mutations, nucleotide repeats are short DNA sequences that are repeated a number of times in a row. For example, a trinucleotide repeat is made up of 3-base-pair sequences, and a tetranucleotide repeat is made up of 4-base-pair sequences. A repeat expansion is a mutation that increases the number of times that the short DNA sequence (i.e. the tri- or tetra-nucleotide) is repeated. When in a coding region, this type of mutation can cause the resulting protein to function improperly. However, when these mutations happen outside of a coding region, they are significantly less likely to have a functional effect.
Alleles
When a segment of DNA of one individual at a locus varies in comparison to the DNA at the same locus of another individual, these different forms of DNA are called alleles. The term allele can be used to refer to a variant form of a gene (i.e. an allele of the gene) or may refer to a variation at a particular locus (i.e. an allele of a SNP).
An individual site in the genome is usually either monomorphic (all sequences are the same at this site) or polymorphic (sequences vary) with only 2 alleles, being the non-mutated wild-type (WT) form (possessed by the majority of individuals in a population) or the mutated form. For example a gene corresponding to the growth hormone (GH) may have a A/T SNP at position 177. This implies a biallelic SNP and may also be described as two alleles of the GH gene, one with an A at position 177 and one with a T at position 177, which can be denoted as 117A>T.
But while in the case of SNPs there are usually only two different alleles at any one position or locus, that is WT or mutated at a specific position, there are many positions at which polymorphisms exist. For example in addition to the mutation at position 177, the growth hormone gene may also have a mutation (for example a C/G mutation) at position 208. In this example, there are then four possible alleles: 117A/208C (i.e. an A at position 117 and a C at position 208), 117A/208G, 117T/208C and 117T/208G. This is referred to as GH being multi-allelic. But an alternative nomenclature is to refer to a combination of alleles at different positions as a haplotype. In this example, there are relevantly 4 haplotypes.
As I have explained, mammals inherit two copies of each chromosome, one from each parent. Consequently, each individual has two copies of each gene, except in the case of male sex chromosomes. Consequently, it is possible for each individual to have different allelic forms of a gene. When an individual has inherited the same allele from their mother and father, they are called homozygous. When an individual has inherited different alleles from their mother and father, they are called heterozygous.
(c) Genotypes and phenotypes
The genotype of an animal is a description of the alleles that it carries at one or more loci. For example, a WT allele of a gene may be expressed as a D (one allelic version of the gene), while a mutated form of the gene (a second allelic version of the gene having a mutation) can be expressed as D’. As mammals inherit two copies of each gene, one from their father and one from their mother, consequently in the example of the D locus there can be three possible genotypes (DD, DD’ or D’D’).
The appearance of an organism is referred to as its phenotype. A phenotype may be a clearly visible trait such as coat colour or growth rate, or it may be a trait that is not observable with the naked eye such as milk fat content. In simple terms, an organism’s phenotype will be determined by a combination of both its genotype and its environment. Accordingly, two individuals may have differing phenotypes or differing observable traits even if they have the same genotype.
Now while the genotype of an individual may influence its phenotype, an alteration of a genotype does not guarantee an altered phenotype. There are several reasons for this.
First, a mutation may not alter an expressed protein or other functional factor. This may be because the mutation is not present in a coding or regulatory region of DNA. Alternatively, the mutation may be in one of these regions, but does not alter the function of these regions. For example a SNP in a coding region may not necessarily alter the amino acid sequence of the protein that is produced as I have explained earlier; one may refer to this as a “silent mutation”. Alternatively, even if the mutation does change the amino acid sequence of the produced protein, the substituted amino acid may not alter the functioning of the protein.
Now proteins exist in three-dimensional structures, with the structure partly determined by the amino acid sequence. Some amino acids are hydrophobic and will have a propensity for the centre of a protein, while others are hydrophilic and therefore will have a propensity for the outer portion of a protein. As such, a substitution of a hydrophilic amino acid for a hydrophobic amino acid can influence the three-dimensional structure of a protein. Further, only portions of the protein are active sites (for example a catalytic site or a site which interacts with another molecule), with the accessibility to these sites, and the activity of these sites, influenced by the three-dimensional structure of the protein. Typically, amino acid substitutions which result in a change in the three dimensional structure of a protein, or are in an active site, will result in a functional change in the protein. But not all amino acids in a sequence are critical. Some amino acid changes will not result in a change in the three-dimensional structure of the protein. Further, the substituted amino acid might not be in an active site of the protein. Additionally, the effect of the alteration in the protein might not be sufficient to alter a biological pathway and therefore may not present as an altered phenotype.
Second, a mutation in an allele might only be in one of the two chromosomes of an individual. If the other, non-mutant allele is a dominant allele (I will explain this in a moment), then the dominant allele will mask the effect of the mutated allele. For example, where one allele of a gene (a non-mutant/WT allele) is denoted D and the mutated allele is denoted as D’, as I have said there are three possible genotypes: DD, DD’ or D’D’. If this gene influences disease resistance of an individual and D is the dominant form of the gene (and has improved resistance) and D’ is the recessive form of the gene (having decreased resistance), then individuals having the DD and DD’ genotype will still have the same phenotype. The dominant allele masks the presence of the recessive allele i.e. neither will have impaired disease resistance. Consequently, only the animals having the D’D’ genotype (homozygous recessive) will have a change in phenotype with a decrease in disease resistance.
More generally, where a mutation does influence a phenotype, for example when a mutation is in the coding sequence and causes a mutated protein, which results in an alteration of a biological process, then this mutation is called a causative mutation.
Traits are typically divided into two different categories based on how they can be measured. The two main categories of traits are referred to as qualitative traits or quantitative traits.
A qualitative trait is a trait in which a clear distinction between the presence of the trait, or the absence of the trait, can be determined. In cattle, an example of a qualitative trait is coat colour (e.g. black or red) or being horned or polled. The presence or absence of these traits is easily determined by the presence or absence of a particular feature. Qualitative traits account for a small proportion of observable traits in an animal.
The majority of traits in animals are considered to be quantitative traits. A quantitative trait is a trait that can be measured in a continuously variable manner, rather than being categorised into two distinct categories. Examples of quantitative traits in cattle are milk production, height and weight.
(d) Sexual reproduction and inheritance
Most mammalian cells are referred to as diploid cells as they include pairs of two homologous (similarly structured) chromosomes, with one of the chromosomes inherited from the father, and one inherited from the mother.
Sexual reproduction in mammals occurs when two gametes (a sperm cell and an egg cell), which each carry a single copy of a chromosome, fuse together to form a diploid cell (a cell with two homologous copies of each chromosome). As such, each gamete (one from the father and one from the mother) contributes half of the genetic component of an individual. In most cases, each gamete produced by the father (sperm) and the mother (ovum) are genetically distinct to the other gametes. This is one reason why siblings are different.
Before elaborating further, it is appropriate to discuss some history.
Mendelian inheritance
The plant hybridisation studies of the Augustinian friar and natural philosopher Gregor Mendel in the mid-nineteenth century provided the genesis of modern genetics. He established various principles concerning dominant and recessive alleles of genes, the segregation of genes and the independence of sorting of genes, although not strictly correct.
Mendel crossed pea plants having either a pure white flower or a purple flower (a qualitative trait). He noted that when the two different phenotypes were crossed, they did not produce a flower which was a blend of the two colours, but rather only produced offspring (denoted as a first generation (F1)) with purple flowers. But when F1 plants, which all had purple flowers, were crossed, their offspring had an assortment of purple and white flowers in a ratio of 3:1 respectively. From this observation, Mendel hypothesised about how genetic information is inherited.
Mendel hypothesised that there were two alternative forms of genes (different alleles), one that encoded for the purple flower (P) and one that encoded for the white flower (P’), and that each of the plants had two copies of these alleles. He also hypothesised that each of the two alleles were separated during reproduction (the law of segregation) and that the purple flower allele was dominant over the white flower allele (the law of dominance). Generally speaking, these hypotheses became established as fundamental aspects of modern genetics.
The experiment performed by Mendel and the genotype and phenotype of the plant crosses is set out in Figure 10 below. As can be seen, all of the progeny from the cross (denoted as F1) of the purple flowered plants with the white flowered plants produced purple flowered offspring. This is caused by the dominant purple allele of the gene (P) masking the presence of the recessive white flower allele (P’). However, when the first generation (F1) are crossed with each other, the resulting progeny (denoted as F2) produce both purple and white flowered plants. As can be seen, there are four possible genotypes in the F2 generation PP, PP’, P’P and P’P’. Due to the dominant nature of P over P’, three of these genotypes have a purple phenotype, and only one (P’P’) has a white phenotype.
Figure 10 – Mendelian inheritance
Mendel also set forth a third law, which has become known as the law of independent assortment. He noted that two distinct qualitative traits (for example, the presence/absence of lobed leaves and flower colour) were inherited separately of each other. That is, the presence of one trait was independent of the presence of the other trait. Generally speaking, this law has proven to be accurate when the genes for given traits are located on separate chromosomes or are spaced sufficiently far apart on the same chromosome. During sexual reproduction these loci are inherited independently of each other.
Now it has been accepted that there are limitations to Mendel’s three laws.
First, very few traits are monogenic (caused by a single gene). The majority of traits in an animal are polygenic traits caused by the interaction of many genes and environmental factors. Consequently, the simple pattern of inheritance observed in Mendel’s experiments is rarely seen in practice.
Second, alleles cannot always be classified as dominant or recessive. Many alleles can be incompletely dominant or incompletely recessive. Many alleles can be co-dominant. In the case of inheritance of incompletely dominant and incompletely recessive alleles, the resulting phenotype will typically be somewhere between the phenotype determined by each of the alleles alone, albeit closer to the incompletely dominant allele. While in the case of co-dominance, or additivity, the final phenotype will be halfway between the phenotype determined by each allele.
Third, not all alleles are independently assorted during reproduction. Many genes are clustered together on the same chromosome. Therefore particular alleles of those genes are more likely to be inherited together. As such, specific phenotypic traits can be linked.
Fourth, one gene can influence several traits and therefore inheritance of one allelic form of a gene may influence multiple traits.
Fifth, there are factors other than simple genetic mutations that can influence a trait, referred to as epigenetic effects. Epigenetic effects are genetic effects that are not related to changes in the DNA code, but can influence the production of specific proteins, and hence traits.
Chromosomal recombination
A consequence of sexual reproduction is genetic variation in offspring. Genetic variation is introduced during a process known as meiosis, whereby gametes are produced. As I have said, mammals are diploid species, having two chromosomes, one from their mother and one from their father. During meiosis, homologous chromosomes swap genetic material with each other to form a new, genetically unique, chromosome. This process is known as chromosomal recombination or chromosomal crossover. The new chromosome then forms the genetic material of the gamete.
The process of gamete formation (meiosis) follows the following steps and is detailed in Figure 11 below:
(a)Chromosomes are duplicated and form an X-shaped structure that consists of two chromatids, with each chromatid being a copy of the chromosome. This process happens for both the maternally inherited chromosome and the paternally inherited chromosome. In essence, at this stage, there are four copies of each chromosome in each cell.
(b)Each chromosome pairs up with its homologous counterpart so that a maternally inherited chromosome and its homologous paternally inherited chromosome are paired together.
(c)Once homologous chromosomes have paired, they exchange portions of genetic material. This process is random, and can happen at almost any position along the chromosome. Consequently, the likelihood that alleles at two loci on any one chromosome will be inherited together is partly dependent on the distance between the two loci. The closer they are, the more likely they are to be inherited together. The further apart the loci are, the more likely it is that a recombination event will happen between the two loci such that they are not inherited together.
(d)Following recombination, the chromatids separate from each other. Each of these chromatids then becomes a chromosome for a gamete. As seen below, each of the four chromatids is genetically distinct from the other. Each gamete possesses a single copy of each chromosome (i.e. each gamete is haploid).
Figure 11 – Meiosis (gamete formation)
During sexual reproduction, haploid gametes fuse to form a diploid cell having one chromosome of each pair inherited from each of their parents.
The mechanisms that lead to independent assortment are explained in Figure 12 below, which shows the production of gametes from one parent. If there are two alleles (with the mutated allele indicated by the presence of a ‘) of two genes (denoted as L and P) wherein the genes are on different chromosomes, there are four possible genotypes of gametes which can be produced (PL, P’L, PL’ and P’ L’). In this scenario, the two alleles of the genes are described as being unlinked because they are on different chromosomes, and the likelihood of inheriting a wild type P allele with a wild type L allele is the same as inheriting it with a mutant L’ (i.e. if a gamete inherits allele L, there is a 50% chance of inheriting a wild type allele P). This is because each allele is inherited independently of the other. In this scenario the two alleles are described as being unlinked because they are on different chromosomes.
Figure 12 – Unlinked alleles
A different scenario is illustrated in Figure 13 below. In that scenario, the alleles of the genes are located on the same chromosome and there is no crossing over (or recombination) between them. Consequently, only two combinations of genotypes are produced (LP or L’P’). The wild-type alleles (L and P) are inherited together, and the mutant alleles (L’ and P’) are inherited together. In this scenario, the two alleles are described as being tightly linked.
Figure 13 – Linked alleles
However, the scenario illustrated above of no recombination does not typically apply to alleles of genes on the same chromosome. Chromosomes undergo recombination during meiosis with their homologous pair. This process introduces the possibility that an allele at one locus on a chromosome will be inherited separately to an allele at a second locus on the same chromosome. If a recombination event happens between the two loci on the chromosome, and the homologous chromosome possesses a different allele, then the two alleles will be separated and a different haplotype will be transmitted to the progeny. This is illustrated in Figure 14 below. As can be seen, despite each chromosome having a particular combination of alleles, that combination of alleles will not always be inherited together. As can be seen in gametes 3 and 4, if a recombination event occurs between the loci of the L allele and the P allele, then the phase relationship between these two alleles is broken and the alleles can be inherited separately. In gamete 3, the L’ allele will be inherited with the P allele, while gamete 4 is the opposite. However, as can be seen in gametes 1 and 2, if a recombination event does not occur between the two loci, then the parental alleles will stay together on the same chromosome in the new gamete.
Figure 14 – Recombination
Consequently, alleles of genes that are linked (i.e. they are in close proximity on the same chromosome) will be inherited together with a higher probability than if they were not linked (i.e. there is a greater than 50% chance that alleles on the same chromosome will be inherited together).
The probability of alleles at two loci on the same chromosome being inherited together is, in part, inversely related to their distance from each other, such that as the distance between the two loci increases, the chance of them being inherited together decreases, until the chance is the same as if they were on separate chromosomes (i.e. 50%). This is shown in Figure 15 below.
Figure 15 – The influence of distance on the probability of two loci being inherited together
Furthermore, as recombination happens during meiosis, the chance of alleles at two loci being separated increases for each successive generation. In other words, linkage disequilibrium (I will elaborate on this in a moment) between two loci decays each generation due to recombination. This is illustrated in Figure 16 below, which shows the decay of linkage disequilibrium (LD) across multiple generations for loci having a differing linkage (i.e. high, medium and low linkage). As can be seen, the higher the recombination fraction, the more quickly the linkage disequilibrium decays across multiple generations (c = recombination fraction, being the ratio of recombined gametes vs total gametes). The closer c is to 0.5, the less linkage there is between the two loci, that is, the more recombination happens between the loci.
Figure 16 – The decay of LD dependent on recombination between two loci
Before proceeding further I should note that there is a debate between the parties as to whether the information contained in Figure 16 and the immediately preceding statement concerning the c value of closer to 0.5 was part of common general knowledge as at the priority date.
Genetic linkage or distance
Genetic linkage is measured in a unit known as a centimorgan (cM). Two alleles which are one cM apart will have approximately a 99% chance of being inherited together.
But while a centimorgan is often used to infer a distance between loci, it is not a true measure of physical distance. The physical distance is measured by the number of nucleotides that separate two loci. The rate of chromosomal recombination per base varies throughout the genome. Certain regions of chromosomes have a higher propensity to recombine than other regions. As such, the physical distance between two loci that are one cM apart, will be lower if the loci are in an area with a high rate of recombination as compared with the distance between two loci in an area with a low rate of recombination.
Linkage disequilibrium
In Figures 12, 13 and 14 set out above, what is pictured is the genotype of a single animal and the gametes produced. The animal carries one chromosome with alleles L and P and a homologous chromosome with alleles L’ and P’. However, other animals in the population may have other genotypes. If across the whole population, a gamete that carries L also carries P or P’ according to the frequencies at which those alleles occur within the population, then the L and P loci are said to be in linkage equilibrium. Conversely, if a gamete carrying L is more likely to carry P, as compared to its frequency within the population, then the L and P loci are said to be in linkage disequilibrium (LD).
Another way to describe LD is to say that across the whole population, the genotypes at the L locus are not independent of the genotypes at the P locus. Consequently, if there is LD and you know an animal’s genotype at the L locus, it may help you to predict the genotype of that animal at the P locus.
The degree of LD can be measured by several statistics. One measure is the correlation between the alleles at the two loci (r). In relation to the above example, if r = 0 there is no LD (i.e. there is linkage equilibrium) and L is inherited with P at the frequency at which P occurs in the population. Contrastingly, if r = 1, then L’ is always carried by the same gametes as P’ and similarly the L and P alleles occur together.
Several factors can cause LD. One important factor is chance. If the effective size of the population is small, then only a small number of gametes form the next generation and a correlation between loci may arise in the sample simply by chance. And in each generation there is another chance sampling of gametes and r may increase or decrease.
Now although LD tends to build up in a small population by chance, recombination breaks down LD. Even if LD is complete (r = 1) recombination between L and P loci may generate the alternative gametes (i.e. LP’ and L’P) and therefore reduce LD. The speed with which recombination breaks down LD is shown in Figure 16 set out above. If the recombination rate is relatively small (i.e. c = 0.001 or 0.01), LD breaks down slowly. However, if the recombination rate is large (i.e. c = 0.10), LD breaks down at a relatively faster rate.
Generally speaking, the LD observed in populations is decreased if the effective population size is large. Contrastingly, the LD observed in populations is increased if the recombination rate between the loci is small. Further, other factors such as the physical distance between each locus, allele interaction effects and selection also affect LD.
(e) DNA genetic markers
A DNA genetic marker is considered to be any DNA sequence that varies from one individual to another. DNA is inherited in chromosomes. Genetic markers that are close to one another on a chromosome are more likely to be inherited together than genetic markers that are spaced further apart on a chromosome or are located on separate chromosomes. In this sense, markers act as landmarks indicating the inheritance of a specific region of DNA. When a relationship is established between a marker and a region that is known to influence a trait (i.e. a QTL as I will explain in a moment), then the marker can be used as a landmark to help trace the inheritance of this QTL.
While any particular marker genotype can be present in several individuals, a combination of genotypes at several markers may be unique to a specific individual, or family, and therefore can uniquely identify the genotype or phenotype of that individual/family. There are many different types of markers used in genotyping animals. However, all are predicated on one of three changes in DNA: (i) insertions/deletions of DNA (indels); (ii) point mutations (single nucleotide polymorphisms) or (iii) duplications (repeats) of DNA (both repeats of small areas of DNA or large chunks of DNA).
QTL
A quantitative trait locus (QTL), as I have referred to in the glossary, is a stretch of DNA that correlates with the genetic value and hence phenotype of an animal for a specific quantitative trait. The QTL is typically in LD with, or contains, gene(s) that influence the trait.
Genetic markers which are themselves in LD with a QTL influencing a trait can be used to identify animals which are more likely to possess the desired allele at the QTL and therefore more likely to possess and/or produce offspring with a desirable value for the trait. Such an approach does not require the genes influencing the trait to be identified, nor does the identified marker (mutation) need to be a causative mutation(s). Rather, this approach relies on identifying markers that are in LD with the causative mutations.
Microsatellites
A microsatellite marker, as I have referred to in the glossary, is a region of repetitive DNA where certain DNA motifs (short sequences of DNA, typically 2 to 5 bp long) are repeated (generally 3 to 50 times).
As a microsatellite can possess alleles that vary from a few repeats to 50 or more repeats of short sequences, these markers are known as multi-allelic markers, that is, markers with more than two possible options. As such, these markers can provide more information than a bi-allelic marker as there are many more possible variants, that is, one individual may have 5 and 7 repeats defining the two alleles present in its genotype, and another may have 6 and 11 repeats defining the two alleles present in its genotype.
Single nucleoside polymorphisms (SNPs)
As I have already explained in the glossary, SNPs are single nucleotide changes in the DNA sequence at a specific locus in the genome. There are millions of SNPs in any given genome. SNPs are considered to be bi-allelic in that there is an ancestral allele and a derived allele.
(f) Animal genomics and the genetic improvement of livestock
Genomics is the study of the genome of individuals to understand the structure of the DNA that encodes the genetic blueprint of the individual. Animal breeders and researchers are interested in how variation in the genome is associated with variation in the traits expressed by an animal.
The way an animal looks and performs is described as its phenotype. This includes not only physical characteristics such as colour or whether it has horns, but also how fast it grows, the composition of its milk or carcass (i.e. the quality of its meat), and how well it copes with stress and disease challenges. Phenotype is determined both by the genotype of the animal (its genome sequence) and its environment. The interaction between genotype and environment complicates how researchers can identify and select the best animals to breed the next generation to be better than the previous one.
By measuring the phenotype of an individual, and its relatives including its siblings and offspring, it is possible to obtain information on the breeding value of an animal or how well its offspring will perform compared to other individuals in the population. Although modern animal breeding uses advanced statistical methodologies such as Best Linear Unbiased Prediction (or BLUP) and very large amounts of computing power, it is still based on tenets such as crossing the best with the best. In this regard, being able to identify what makes them the “best of the best” genotypically, that is, selection based on genetics rather than selection of a specific genotype, and selecting for those traits has large commercial value for those in the livestock industry who want to breed for desirable traits. Further, the genotype (or genetic information) can provide information on the potential performance of animals in order to optimise their management and improve economic returns.
Different techniques have been available to study the contribution of different genes and their individual alleles to quantitative traits. Allelic variation can contribute to, or be linked to, a change in a trait. By knowing such information in the context of animal sorting and breeding, one can endeavour to identify animals having desirable genes (or more strictly alleles) to then form a view as to whether an animal has a desirable trait, e.g. meat tenderness, milk production, etc.
There were various different approaches identified in the evidence of Professor Michael Goddard called by MLA and Professor Graham Plastow called by Branhaven. It is useful to summarise them at this point. For the most part, they can be taken to be approaches used as at the priority date. But there was considerable debate with respect to approaches 5 and 6 in terms of what was known about them, how they were described and how they were applied (if at all) as at the priority date. For present purposes, I will postpone that debate concerning approaches 5 and 6 and return to it later.
Approach 1 – phenotype selection/selective breeding
The first approach may be called the phenotypic selection approach or selective breeding. In 2002, a standard model for this approach was to estimate the genetic parameters for the trait of interest and to use these to calculate estimated breeding values (EBVs) for animals that were candidates for selection as breeding animals.
Generally, and applying the principle in Kimberly-Clark at [25], MLA says that the specification does not:
enable the addressee of the specification to produce something within each claim without new inventions or additions or prolonged study of matters presenting initial difficulty. (citation omitted)
(b) Analysis
Now as a preliminary matter, I would observe that the observations in Tramanco Pty Ltd v BPW Transpec Pty Ltd at [207] and Apotex Pty Ltd v Warner-Lambert Company LLC (No 2) at [244] have little application to the present case. The claim under consideration in Tramanco at [207] was in form and in substance a claim to a method for producing alternative results or outcomes. It is apparent that his Honour regarded the claim in Apotex v Warner-Lambert in similar terms. But claim 1 of the 253 Application is not a claim to such a method. It is not a claim to a method for producing alternative results or outcomes. Rather it is a claim to a general method that may be employed using any combination of features within the scope of the claim.
Further, I agree with Branhaven that MLA’s contentions fail to apply the Kimberly-Clark test. The skilled person could readily put the invention into practice, by performing an embodiment of the invention within the scope of each claim. Moreover, this could be done without undue experimentation. And this is all that is required. The evidence does not establish that the skilled person could not use an embodiment of the method within claim 1 of the 253 Application without undue experimentation. For example, he could take any three or more of the 2,510 specified SNPs and use them in the method of the invention to infer the potential for a trait with which they were shown to be associated. In my opinion, the evidence does not clearly establish otherwise.
Now MLA has pointed to four matters in respect of which it is said that the description in the specification is deficient. But none of these matters supports any finding of a lack of sufficiency.
First, MLA says that the skilled person would need to work out if the SNPs proposed to be used in the claimed method were in genes. But this is something that the skilled person could readily do, as Professor Plastow and Dr Sonstegard explained. At the priority date this could be done by comparing sequence homology with publicly available information concerning the human genome. And from the time of filing of the 253 Application, the bovine genome could be used as the reference point. The location of a SNP within a gene is for molecular geneticists well within the skill of the calling. Moreover, the difficulties and uncertainties said by MLA to be associated with this process are overstated. As a skilled person could employ a method within claim 1 using any three or more SNPs that meet the requirements of the claim, it is not the case that large numbers of SNPs would need to be assessed and located within genes in order to apply the invention. Moreover, it would have been well within the skill of the calling to identify a limb (b) SNP.
Second, although MLA says that the SNPs would need to be validated, this is something that the skilled person could readily do. As some of the evidence established, validation is something that would be done as a matter of course in any case where the population of interest is genetically different to the research population. Moreover, I agree with Branhaven that it is not to the point that the 253 Application does not show that the 2,510 specified SNPs were validated in a population other than the research population. There would have been little point to doing this for the purposes of the 253 Application. As a practical matter, the SNPs would have needed to be validated again in any event by the skilled person seeking to practise the invention in his population of interest. It would only be where the population of interest happened to be the same as or genetically similar to the validation population (if there had been validation) in the 253 Application that this could be avoided. Further, in my view the work involved in validating SNPs in a population of interest is routine, and not undue experimentation. I accept Branhaven’s submission that it is part of putting the method into effect and would be done as a matter of course.
Third, although MLA submits that it would be necessary to re-do at least example 2 for traits other than the five traits the subject of the association study in the 253 Application, such a proposition does not properly apply Kimberly-Clark. The method of claim 1 is not specific as to the trait of interest. It extends to any trait. I agree with Branhaven that enablement in relation to any one or more of the five identified traits is sufficient. Moreover, MLA’s characterisation of the work involved in practising the invention in relation to other traits is debatable. As Branhaven says, it would not be necessary to “re-do” example 2 of the 253 Application for this purpose. Example 2 was part of the inventors’ GWAS approach that resulted in the development of the panel of 2,510 SNPs associated with a variety of traits. The invention could be put into practice with far fewer SNPs. The method of claim 1 requires only three or more SNPs associated with a trait of interest. I am not satisfied that the skilled person could not identify a sufficient number of SNPs and their association with a trait in order to use the claimed method.
Fourth, MLA says that an association study would need to be conducted for non- specified SNPs to identify their association with a trait. But this again fails to apply Kimberly-Clark.
Finally, let me briefly deal with two other matters. First, the decision of Jagot J in Gilead Sciences Pty Ltd v Idenix Pharmaceuticals LLC does not assist MLA. Her Honour’s acceptance that a “research project” would be required was quite a different context. But in the present case, 2,510 SNPs have been identified as being associated with one or more of five traits. The skilled person can elect to use them in the claimed method. It is a matter for the skilled person if he or she chooses instead to use other SNPs to carry out the method. The fact that this might involve some additional time and effort does not establish insufficiency. Second, MLA’s reliance on correspondence from Branhaven’s previous attorneys does not carry the matter far. It adds little to my assessment of whether the claimed invention has been sufficiently described to refer to representations made during the course of prosecution. Further, the letter does not in terms admit that, having been provided with the information in the 253 Application, the skilled person would be unable to validate the specified SNPs without undue experimentation.
I am not clearly satisfied that MLA’s insufficiency ground has been made out.
LACK OF FAIR BASIS
Section 40(3) requires a real and reasonably clear disclosure in the body of the specification of what is claimed. The language of s 40(3) points to a comparison between the claims and what is described in the body of the specification only. As stated by Barwick CJ in Olin Corporationv Super Cartridge Co Pty Ltd (1977) 180 CLR 236 at 240:
the question is a narrow one, namely whether the claim to the product being new, useful and inventive, that is to say, the claim as expressed, travels beyond the matter disclosed in the specification.
Section 40(3) does not use the word “invention”, but it requires that the claims “be fairly based on the matter in it that discusses the ‘invention’”; Lockwood (No 1) at [53]. This is the embodiment(s) which is described and around which the claims are drawn, but it does not mean the inventive step taken by the inventor or the advance in the art made by the inventor. Lockwood (No 1) described the relevant test in the following terms (at [68] and [69]):
Erroneous principles. The comparison which s 40(3) calls for is not analogous to that between a claim and an alleged anticipation or infringement. It is wrong to employ “an over meticulous verbal analysis”. It is wrong to seek to isolate in the body of the specification “essential integers” or “essential features” of an alleged invention and to ask whether they correspond with the essential integers of the claim in question.
“Real and reasonably clear disclosure”. Section 40(3) requires, in Fullagar J’s words, “a real and reasonably clear disclosure”. But those words, when used in connection with s 40(3), do not limit disclosures to preferred embodiments.
The circumstance that something is a requirement for the best method of performing an invention does not make it necessarily a requirement for all claims; likewise, the circumstance that material is part of the description of the invention does not mean that it must be included as an integer of each claim. Rather, the question is whether there is a real and reasonably clear disclosure in the body of the specification of what is then claimed, so that the alleged invention as claimed is broadly, that is to say in a general sense, described in the body of the specification.
Fullagar J’s phrase serves the function of compelling attention to the construction of the specification as a whole, putting aside particular parts which, although in isolation they might appear to point against the “real” disclosure, are in truth only loose or stray remarks. (footnotes omitted, save that the italicised phrase is drawn from Rehm Pty Ltd v Websters Security Systems (International) Pty Ltd (1988) 81 ALR 79 at 95 per Gummow J)
So, one should not use an “over meticulous verbal analysis”. Further, the focus is not on an identity of language between the claims and the disclosure in the body of the specification. Rather, one is looking for a generalised disclosure in the body that provides support for the claims in substance. Moreover, it is inappropriate to isolate in the body of the specification essential integers or features of an alleged invention and to ask whether they correspond with the essential integers of the claim.
Now fair basis can be established by a comparison with the consistory clause(s). But even if a claim is based on and mirrors the form of the consistory clause(s), it will not be fairly based if other parts of the specification show that the invention is narrower than the consistory clause(s). What has been described as a “coincidence of language” between a claim and part of the body of a specification does not per se establish fair basing if that part of the language of the specification does not reflect the description of the invention in the light of the specification as a whole.
Further, it is appropriate to restate that the complete specification is not to be read in the abstract, but is to be construed in the light of common general knowledge and the relevant art before the priority date.
Further, where a feature included in a claim is a limiting feature, there is no need for it to be the subject of an explicit disclosure in the body of the specification, if the subject matter of the claim falls within the scope of what is more broadly described in the specification. As explained in DSI Australia (Holdings) Pty Ltd v Garford Pty Ltd (2013) 100 IPR 19; [2013] FCA 132 at [240] per Yates J:
… the inquiry as to fair basis is directed to the question of claim width: see, for example, Olin Corporation at CLR 240 ... A claim may be fairly based for the purposes of s 40(3) of the Act where it adds a feature to a combination otherwise described in the specification and, by that addition, limits the described invention, as a matter of definition, to a more restrictive form than that to which the patentee might otherwise be entitled. In short, a claim may be fairly based for the purposes of s 40(3) of the Act even when all the characteristics by which the invention is defined in the claim are not described in the body of the specification itself, provided those characteristics are truly limiting ones in the sense that I have described.
Relatedly, the claims need not be restricted to precise embodiments described in the specification. As Gummow J said in Sartas No 1 Pty Ltd v Koukourou & Partners Pty Ltd (1994) 30 IPR 479; [1994] FCA 936 at 497:
it is no objection to any particular claim that it claims a monopoly for less than every feature described in the body of the specification. It cannot be the case that, for example, a claim is restricted to the precise embodiment which is depicted in the body of the specification.
(a) MLA’s arguments
MLA says that the claims essentially include methods of using any three SNPs from anywhere in the bovine genome that are associated with any trait to identify cattle with that trait. The only restrictions are that at least one of the SNPs is a specified SNP or a non-specified SNP i.e. within +/- about 500,000 nucleotides of a specified SNP, which MLA says covers two thirds of the bovine genome, and at least two SNPs occur on different genes. MLA says that the claims are extraordinarily wide and do not reflect what is described as the invention in the specification. MLA says that they travel beyond the matter described in the specification in at least the following two ways.
First, MLA says that there is no basis for a claim to any of the specified SNPs being associated with any trait other than those five traits examined in the association study, which are all carcass traits. It says that the 253 Application does not provide any basis for considering that the specified SNPs are associated with anything other than the five identified traits. Accordingly, insofar as the claims include SNPs that are associated with traits other than those five carcass traits, for example, disease resistance, they travel beyond the invention described in the specification.
Second, MLA says that there is no basis for any SNP other than those identified as associated with one of the five traits. It asserts that no association with any trait is shown with any non-specified SNP. The SNPs identified in Example 3 of the 253 Application concern specified SNPs. Further all of the SNPs in use in the LD analysis, and shown to be associated, are one of the specified SNPs. Further, in practice, the +/- about 500,000 nucleotide limitation is not a real limitation, as it covers more than two thirds of the bovine genome. MLA says that there is no basis for the claims to include any SNP that is not a specified SNP. Further, MLA asserts that Branhaven identified that the invention is in the panel of SNPs provided. MLA says that Branhaven’s experts also understood the invention as being to a subset of SNPs. MLA says that it is apparent from Professor Plastow’s characterisation of the 2,510 specified SNPs as a “windfall” and a “remarkable jump” that this is where he considered the true value of the invention to lie. Accordingly, MLA says that the claims lack fair basis in that they travel well beyond the panel of SNPs identified in the specification.
(b) Analysis
I would reject MLA’s fair basis attack.
First, although MLA contends that there is no basis for a claim to any of the specified SNPs being associated with any trait other than those five traits examined in the association study, I agree with Branhaven that this misapplies the principles of fair basis.
Claim 1 is commensurate with the description in the body of the specification. As Branhaven points out, the broad form of the invention described at [0027] is not limited to the use of any particular SNP associated with any particular trait. And I also agree that the embodiment described at [0030] is also not so limited. Further, later embodiments are similarly broadly expressed. And as for paragraphs of the specification that refer to particular traits, including the five traits that were the subject of the association study, these are expressed to be
non-limiting, preferred embodiments of the invention: see [0027] and [0090].
In my view such disclosures provide ample fair basis for other traits. Further, I agree with Branhaven that there is no need for the description to establish, by experiment or otherwise, that any of the specified SNPs is in fact associated with any other trait. No authority discussing fair basis and binding upon me supports any such requirement.
Further, MLA’s argument focuses on particular integers of claim 1, not the claim as a whole. It is the claim that must be fairly based. The claim is to a method for identifying a trait in a bovine subject that comprises, relevantly, identifying in a nucleic acid sample of the subject at least three SNPs associated with the trait. The claim does not require that any of the 2,510 specified SNPs will necessarily be associated with any particular trait whether within or outside the five traits the subject of the association study. They may or may not be. Moreover, the evidence does not establish that the 2,510 specified SNPs would not be useful to infer an association with other traits outside the five traits.
Second, as to MLA’s contention that there is no basis for a claim to any SNP other than the 2,510 specified SNPs, I would also reject such a contention. There is support in the specification for a claim to a method that involves the use of SNPs other than the 2,510 specified SNPs; see, for example, [0030], [0035] and [0126] in the detailed description. The method described is not limited to the specified SNPs. The identified SNPs are examples of SNPs provided that can be used in the method. But the description teaches that the method can also be employed using other SNPs, provided that they satisfy the elements of claim 1, including being associated with a trait of interest, and for a limb (b) SNP being in relevant linkage disequilibrium (as I have explained elsewhere and as I will require by way of amendment) with the identified limb (a) SNP.
I reject MLA’s fair basis attack.
LACK OF CLARITY AND DEFINITION
A valid claim is required to define with sufficient certainty the scope of the monopoly being claimed (s 40(3)). Given that a patent is a public instrument, the claim must be defined in such a way that it is not reasonably capable of being misunderstood so that others know the “exact boundaries of the area within which they will be trespassers”: Electric & Musical Industries Ld v Lissen Ld (1939) 56 RPC 23 at 39 per Lord Russell of Killowen. A claim will lack clarity if a person skilled in the relevant art cannot ascertain whether what he proposes to do falls within the claim’s ambit.
But lack of precise definition will not be fatal to the validity of a claim as long as it provides a workable standard suitable to the intended use. But as stated in Kauzal v Lee (1936) 58 CLR 670 at 685 per Dixon and McTiernan JJ:
[v]agueness of description, want of particularity and evident indistinctiveness of thought may be the source of so much uncertainty as to the scope of the monopoly that the claim fails to fulfil the requirement of stating with definiteness to what the patentee is exclusively entitled.
A claim is clear if either there is no ambiguity or any ambiguity is resolvable by properly construing the claim applying the principles that I have set out previously. But I accept that a claim is bad if no reasonably certain construction can be given to it. And I also accept that I am not bound to find a meaning for a claim nor to approach a claim with the conviction that its language is capable of a reasonable construction when carefully examined.
In Flexible Steel Lacing Co v Beltreco Ltd (2000) 49 IPR 331; [2000] FCA 890, Hely J held that each of the method and product claims for pulling lagging used in conveyor systems was invalid for lack of clarity. In respect of the method claim, he said at [107]:
The method claim is fairly open to more than one meaning not because of grammatical problems but because, even to a skilled reader, it would not be clear which of two methods claim 13 describes.
In respect of the product claim, he held at [131]:
Thus, I conclude that the product claim is obscure; it is fairly and equally open to diverse meanings, namely that the sipes run at right angles across the strip, on the one hand, or that the sipes run along the length of the strip on the other. Another possibility is that the claim embraces both. Sometimes, ambiguity or insufficiency in description can be resolved by a skilled addressee through the application of commonsense and common knowledge: cf Innovative Agriculture Products Pty Ltd v Cranshaw (1996) 35 IPR 643 at 666. I do not think that this is such a case.
Finally, if a claim is clear, it is not to be made obscure or treated as obscure by taking elements of a preferred embodiment not referred to in the claim and artificially creating obscurity.
Let me turn to the question of definition.
Section 40(2)(b) requires the complete specification “to end with a claim or claims defining the invention”. In General Tire & Rubber Co v Firestone Tyre and Rubber Co Ltd (1971) 1A IPR 121, the Court stated at 167 that “the issue of definition is to be considered as a practical matter and little weight is to be given to puzzles set out at the edge of the claim which would not as a practical matter cause difficulty to a manufacturer wishing to satisfy himself that he is not infringing the patent”. The Court also observed that allowances should be made for any difficulties of the case, so that an alleged issue of want of definition should always be considered in relation to the particular facts. It concluded (at 167 and 168):
It is clear in our judgment that the question whether the patentee has sufficiently defined the scope of his claims is to be considered in relation to the facts of each case, that allowance is to be made for any difficulties to which the circumstances give rise, and that all that is required of the patentee is to give as clear a definition as the subject matter admits of. It is also clear in our judgment that, while the court is to have regard to all the relevant facts, the issue of definition is to be considered as a practical matter and little weight is to be given to puzzles set out at the edge of the claim which would not as a practical matter cause difficulty to a manufacturer wishing to satisfy himself that he is not infringing the patent. We accept also that definition of the scope of a claim is not necessarily insufficient because cases may arise in which it is difficult to decide whether there has been infringement or not provided the question can be formulated which the court has to answer in the issue of infringement.
A claim will be bad if it fails to define the monopoly claimed so that the skilled addressee of the patent can know the exact boundaries of the area within which they will be trespassers.
MLA contends that there is no basis for a claim to any of the specified SNPs being associated with any trait other than those five traits examined in the association study, which are all carcass traits. The 253 Application does not provide any basis for considering that the specified SNPs are associated with anything other than the five identified traits. Insofar as the claims include SNPs that are associated with traits other than those five carcass traits, for example, disease resistance, they travel beyond the invention described in the specification.
Further, MLA contends that there is no basis for any SNP other than those identified as associated with one of the five traits. No association with any trait is shown with any non-specified SNP. In practice, the +/- about 500,000 nucleotide limitation is not a real limitation, as it covers more than two thirds of the bovine genome. There is no basis at all for the claims to include any SNP that is not a specified SNP. At the priority date, many such SNPs were yet to be discovered (but they have since been discovered).
MLA says that as a consequence of the above two matters, each of the claims fails to define the invention described in the specification. As is apparent from my reasons I would reject these contentions.
In terms of lack of clarity and for the reasons that I have already expressed in the construction section, claim 1 (and analogous claims) will require amendment to:
(a)define “associated” in terms of statistical significance at the p value of equal to or less than 0.01 (or such other measure as I decide after hearing from counsel further);
(b)require each of the 3 SNPs to satisfy that level of statistical significance (to be discussed further with counsel); and
(c)require the limb (b) SNP to be in LD with the relevant limb (a) SNP and to the requisite degree (to be discussed further with counsel).
As presently formulated, claim 1 and analogous claims fail for lack of clarity and proper definition, and also give rise to aspects of inutility. But if such amendments are made, these matters may be rectified.
I should note that I have not made any final decision on whether amendment will be permitted and if so its form. I will hear further from the parties on that aspect.
CONCLUSION
As I have indicated in these reasons, aspects of the claims in their present form are deficient in terms of:
(a)lack of clarity;
(b)a failure to define the invention ; and
(c)related to some questions of construction, lack of utility.
Accordingly I would uphold MLA’s appeal to this extent. But otherwise I would dismiss MLA’s appeal. I will not, however, make any final orders until Branhaven has been given the opportunity to consider whether to apply to amend any of the claims to address the concerns that I have expressed in these reasons.
I will hear further from counsel as to the course that they suggest should be taken and the orders that they suggest should be made consequential upon these reasons.
I certify that the preceding nine hundred and forty-nine (949) numbered paragraphs are a true copy of the Reasons for Judgment herein of the Honourable Justice Beach. Associate:
Dated: 9 February 2018
154
18
2