Academisch Ziekenhuis Leiden and BioMarin Technologies B.V. - [2018] APO 49

IP AUSTRALIA
AUSTRALIAN PATENT OFFICE
Academisch Ziekenhuis Leiden and BioMarin Technologies B.V. [2018] APO 49
Patent Application: 2015252074

Title:Method for efficient exon (44) skipping in Duchenne Muscular Dystrophy and associated means

Patent Applicant:                  Academisch Ziekenhuis Leiden and BioMarin Technologies B.V.
Delegate:  Dr A. Lim
Decision Date:  31 July 2018
Hearing Date:  Written submissions filed on 29 January 2018

Catchwords: PATENTS – examiner objection – grounds of manner of manufacture and inventive step – invention relates to an antisense oligonucleotide capable of inducing exon skipping – substance of the invention is an artificially made chemical compound – the claimed antisense oligonucleotide is a manner of manufacture – ground of manner of manufacture not made out – claims 1, 2, 3 and 14-17 lack an inventive step in light of prior art citation – ground of inventive step made out

Representation: Patent attorney for the applicant: Griffith Hack

IP AUSTRALIA
AUSTRALIAN PATENT OFFICE
Patent Application: 2015252074

Title:Method for efficient exon (44) skipping in Duchenne Muscular Dystrophy and associated means

Patent Applicant: Academisch Ziekenhuis Leiden and BioMarin Technologies B.V.
Date of Decision: 31 July 2018
DECISION
The invention claimed in each of claims 1-14 is directed to a manner of manufacture.
Each of claims 1, 2, 3 and 14-17 lacks an inventive step in light of the prior art. The evidence on file does not establish that each of claims 4-13 lacks an inventive step.
It may be possible to overcome the deficiencies by amendment. According to regulation 13.4(1)(g), the present application will not lapse for failure to gain acceptance until a period of 3 months from the date of this decision.
REASONS FOR DECISION

Patent application 2015252074 (the present application) was filed by Academisch Ziekenhuis Leiden and BioMarin Technologies B.V. (the applicant) on the 04 November 2015. The present application is a divisional application of 2009247037 (the parent application). The parent application was examined and a patent was granted on 19 May 2016. The parent application claims priority from EP 08156193.8 (filed 14 May 2008) and US 61/128,010 (filed 15 May 2008).
The present matter relates to objections raised during examination of the present application. The applicant requested to be heard in relation to those objections, and a hearing was conducted by means of written submissions.
1. The relevant law
The request for examination of the present application was filed on 05 January 2016. Consequently, the examination of the present application is governed by the Patents Act 1990 (the Act) as amended by the Raising the Bar Act. Amendments to sections 7, 40 and 49 of the Act apply to the present case as a consequence of Schedule 1, items 55(1)(e) and 55(4)(b) of the Raising the Bar Act.
The standard of proof that applies to the examination of the present application is the balance of probabilities. I must accept the present application if satisfied on the balance of probabilities that the application complies with the Act.[1] If I am not so satisfied, then I can refuse the application.[2]
[1] Section 49 of the Act as amended.
[2] Explanatory Memorandum to the Raising the Bar Bill, item 14.
2. The specification
The specification as filed has 51 pages of description, 3 pages of drawings and 28 claims. The applicant filed a first set of proposed amendments at the same time the request for examination was filed, on 05 January 2016. The amendments proposed to delete some of the claims and reduce the claim set to 17 claims. A second set of proposed amendments was filed on 03 May 2017 in response to the first adverse Examination report. A third set of proposed amendments was filed on 21 November 2017 in response to the second adverse Examination report. The second set and third set of amendments proposed changes to the claims and the description. It is the third set of amendments filed on 21 November 2017 that I must consider in this decision. Throughout this decision, whenever I refer to the present application that is the application as proposed to be amended on 21 November 2017.
2.1 The field of the invention
The specification states that the field of the invention relates to human genetics and in particular the modulation of splicing of the human Duchenne Muscular Dystrophy gene.[3]
[3] The present application at page 1.
2.2 The aim of the invention
Muscular dystrophy (MD) is stated to be genetic diseases that are characterised by progressive weakness and degeneration of skeletal muscles.[4] Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are stated to be the most common childhood forms of MD.[5] DMD is a severe, lethal disorder and DMD sufferers often die due to respiratory failure or heart failure.[6] BMD patients are stated to remain ambulatory until later in life and have near normal life expectancies.[7]
[4] ibid.
[5] ibid.
[6] ibid.
[7] ibid.
DMD and BMD are stated to be caused by genetic defects in the DMD gene which encodes dystrophin, a muscle protein involved in maintaining muscle fibre stability during contraction.[8] DMD mutations in the dystrophin gene are stated be characterised by frame shift insertions or deletions or nonsense point mutations and result in the absence of a functional dystrophin.[9] BMD mutations keep the translation reading frame of the nucleotide sequence intact and allow the synthesis of a partly functional dystrophin.[10]
[8] ibid.
[9] The present application at pages 1-2.
[10] ibid.
The specification states that antisense-mediated exon skipping has been investigated over at least 20 years as a possible treatment for DMD.[11] The aim of antisense-mediated exon skipping is to transform out-of-frame mutations present in DMD sufferers into in-frame BMD-like mutations that result in the synthesis of partially functional dystrophin which will prolong the viability of the muscles.[12]
[11] The present application at page 2 which cross-references a journal article in Nature Review Genetics, October 2003, Volume 4, pages 774-783.
[12] The present application at page 2 which cross-references a journal review article in RNA, 2007, Volume 13, pages 1609-1624.
The specification states:
“The present invention identifies four different regions in exon 44 that are particularly suited for inducing skipping of exon 44. The invention thus provides a method for modulating splicing of exon 44 of the DMD gene in a cell, the method comprising providing said cell with a molecule that binds to a nucleotide sequence comprising SEQ ID NO. 1: 5'-GUGGCUAACAGAAGCU; SEQ ID NO. 2: 5'-GGGAACAUGCUAAAUAC, SEQ ID NO. 3: 5'AGACACAAAUUCCUGAGA, or SEQ ID NO. 4: 5'-CUGUUGAGAAA. This molecule preferably binds or is complementary to any of SEQ ID NO: 1, 2, 3, or 4 when SEQ ID NO: 1, 2, 3, or 4 is present within exon 44 of the DMD pre-mRNA.
Throughout the application, the expression ‘inducing skipping’ is
[13] The present application at page 3a.
synonymous of ‘modulating splicing’.”[13]
I understand the aim of the invention is to provide a method of treating DMD or BMD patients by inducing skipping of exon 44 of the DMD gene. This method involves providing the cell with a molecule that binds to particular sequences that are present within exon 44 of the DMD pre-mRNA. The molecule is stated to be preferably a nucleotide sequence that is complementary to a sequence selected from exon 44 of the DMD pre-mRNA. I also understand that the terms “inducing skipping” and “modulating slicing” refer to the same process.
The specification states:
“In higher eukaryotes the genetic information for proteins in the DNA of the cell is encoded in exons which are separated from each other by intronic sequences. …. The transcription machinery of eukaryotes generates a pre-mRNA which contains both exons and introns, while the splicing machinery, often already during the production of the pre-mRNA, generates the actual coding region for the protein by splicing together the exons present in the pre-mRNA.”[14]
[14] The present application at page 15. I note the present application at page 4 states that the term “pre-mRNA” is “a non-processed or partly process precursor mRNA that is synthesized from a DNA template in the cell nucleus by transcription.”
I understand the term “exon” to mean genetic information that encodes proteins. A dictionary meaning of “intron” is a polynucleotide sequence in a nucleic acid that does not code information for protein synthesis and is removed before translation of messenger RNA.[15]
[15] Merriam-Webster Dictionary, an online version accessed at on 07 June 2018.
From the above-quoted portion of the specification, I understand the term “splicing” is a technical term that is understood by the person skilled in the art to mean a process in which introns present in precursor messenger RNA (pre-mRNA) transcript are removed and exons joined together to form a mature messenger RNA (mRNA). This interpretation is consistent with the definition provided in a journal review article cross-referenced by the present specification, Nature Review Genetics, October 2003, Volume 4, pages 774-783.[16]
[16] The present application at page 2 cross-references Nature Review.
2.3 The embodiments of the invention
The specification states:
“A first aspect provides an oligonucleotide, capable of inducing skipping of at least 30% of exon 44 of dystrophin pre-mRNA when tested in a muscle cell of a DMD patient using RT-PCR, having a length from about 18 to about 30 nucleotides, excluding a length of 24 nucleotides, which is an antisense oligonucleotide to SEQ ID NO. 1: (5'-GUGGCUAACAGAAGCU-3') and which comprises a nucleotide analogue being a LNA (locked nucleic acid).”[17]
[17] The present application at page 3.
I understand one embodiment of the invention is an oligonucleotide which has the capability to induce skipping of exon 44 of dystrophin pre-mRNA. The oligonucleotide has:
·A specific length;
·A sequence that is antisense to SEQ ID NO. 1; and
·A nucleotide analogue that is a LNA.
The term “antisense oligonucleotide” is a technical term that the person skilled in the art would understand to be a nucleotide sequence that has complementary base pairs to the target sequence, in this case complementary sequences with SEQ ID NO. 1. This interpretation is consistent with the statement from the specification, and quoted previously, which states molecules that bind sequences within exon 44 of the DMD pre-mRNA are preferably complementary to SEQ ID NO. 1.[18]
[18] The present application at page 3a.
Other embodiments of the invention described include:
·a pharmaceutical composition comprising the oligonucleotide according to the first aspect and a pharmaceutically acceptable carrier;
·use of the oligonucleotide or pharmaceutical composition in the manufacture of a medicament for treating a DMD or BMD patient;
·an in vitro method for inducing skipping of exon 44 of dystrophin pre-mRNA in a cell by providing the cell with the oligonucleotide or pharmaceutical composition; and
·a method of treating a DMD or BMD patient comprising administering to the patient the oligonucleotide or pharmaceutical composition. [19]
[19] The present application at page 3.
2.4 Technical background
Before I discuss the examples of the invention, it is useful to review some concepts which form the basis for antisense-mediated exon skipping and what was known about the state of the art in regard to the technology. In my review, I will draw upon the description in the specification and review articles cited and incorporated by reference into the specification. The citation details of the particular review articles incorporated by reference into the present application, which I draw upon, are:
·Aartsma-Rus, A. and van Ommen, G-J. B., “Antisense-mediated exon skipping: A versatile tool with therapeutic and research appliactions”, RNA, 2007, Volume 13, pages 1609-1624 (RNA article); and
·van Deutekom, J. C. T. and van Ommen, G-J. B., “Advances in Duchenne Muscular Dystrophy gene therapy”, Nature Review Genetics, October 2003, Volume 4, pages 774-783 (Nature Review).
Antisense-mediated exon skipping
The specification states exon skipping is achieved by providing a cell expressing the pre-mRNA of said mRNA with a molecule capable of (1) interfering with sequences that are required for the enzymatic process of splicing, or (2) interfering with an exon inclusion signal sequence which recognises a particular exon is to be included in the mature mRNA. [20]
[20] The present application at page 4.
The specification also states:
“Exon skipping can be induced by antisense oligonucleotides (AON) directed against the splice donor or splice acceptor site of a splice junction that are involved in the enzymatic process of exon joining, or against exon-internal sequences.”[21]
[21] The present application at page 2.
I understand that in the present invention the molecule which is provided to a cell expressing the pre-mRNA to induce exon skipping is an antisense oligonucleotide (AON). I also understand that the AON is capable of interfering with a sequence that is required to allow the enzymatic process of splicing or an exon inclusion signal sequence.
Exon skipping induced by targeting exon-internal sites has been reported to be successful in the DMD gene.[22] I understand the exon-internal AONs are suggested to act by steric blocking of proteins that are involved in the spliceosomal complex.[23]
[22] RNA article at page 1611.
[23] RNA article at page 1613.
In summary, I understand AONs are used to block splicing signals and, by doing so, induce exon skipping. My interpretation is consistent with statements in the Nature Review of the mechanism of antisense-mediated exon skipping. I reproduce the following schematic representation from the review:[24]
[24] Nature Review, page 778, Figure 2.
I understand from the schematic representation that as a result of an AON binding to a target sequence in exon 44, exon 44 is “skipped” over and the disrupted reading frame is restored. This results in an internally deleted, but partially functional protein. I further understand from the Nature Review that a spliceosomal complex, which consists of RNA molecules and protein components, mediates the excision of introns from the pre-MRNA and the ligation of two non-sequential exon termini.[25]
[25] Nature Review, page 778.
The specification also states exon skipping results in a mature mRNA which lacks a particular exon that is normally present, and consequently leads to the expression of an altered protein.[26] The altered protein is a partially functional protein and in a preferred embodiment is an in-frame BMD-like dystrophin protein with comparable functionality to dystrophin from an individual with BMD—the less severe form of muscular dystrophy.[27] The specification further states that the technology for exon-skipping is directed towards the use of AONs.[28] Providing a cell with an AON of the present invention promotes exon 44-skipping and results in an increase in the production of partially functional dystrophin protein and/or a decrease in the production of an aberrant or less functional dystrophin protein.[29]
[26] The present application at pages 4 and 15.
[27] The present application at pages 9 and 11.
[28] The present application at page 15.
[29] The present application at pages 9 and 13.
Design of AON
The specification states that one of the first considerations of a skilled person designing an AON would be choosing an AON that is able to bind a particular sequence of the target exon—exon 44 in the present case.[30] Techniques for assessing binding of nucleotide sequences to a target sequence, such as gel mobility shift assay, are stated to be known to the skilled person.[31]
[30] The present application at page 7.
[31] The present application at page 5.
The specification states that the skilled person would also know the following factors can be taken into account for optimising the design of the AON: [32]
·The AON does not contain a CpG—this is because the presence of a CpG is usually associated with increased immunogenicity of the oligonucleotide which is undesirable since increased immunogenicity may induce breakdown of muscle fibres;
·The AON does not contain a G-quartet motif—this is because a G-quartet motif has the tendency to cause multimerisation or aggregation of single-stranded oligonucleotides and this results in reduced efficiency of the oligonucleotide; and
·The AON has acceptable RNA binding kinetics and/or thermodynamic properties— this is determined in part by the melting temperature of an oligonucleotide or the free energy of the AON-target exon complex.
[32] The present application at pages 6-7.
The specification states that the skilled person would know that the parameters available for optimising any of the above-mentioned factors are (1) varying the length of the AON, (2) choosing a distinct stretch within the target exon to which the AON binds, (3) altering the chemical make-up of the AON, or (4) a combination of these parameters.[33]
[33] The present application at pages 7-8.
I understand the specification to be telling me that the skilled person when designing an AON would as a matter of course (a) choose an AON that is able to bind a particular sequence of the target exon, and (b) optimise the AON by varying the AON length, choice of nucleotide sequences to which AON would bind in the target exon, AON chemical make-up, or a combination of the mentioned parameters. The statements in the RNA article also indicate that it was known by 2007 (the publication date of the RNA article) that AON length, target sequences within the exon, and AON backbone chemistry are important factors for enhancing exon skipping efficiency.[34]
[34] RNA article at pages 1613 and 1618-1619.
Chemical modifications of AONs
The specification states the nucleotide sequence of a molecule of the invention may contain RNA residues, one or more DNA residues and/or one or more nucleotide analogues.[35] As discussed above, the molecule of the invention is an AON. A nucleotide analogue is defined in the specification as:
“…. a residue having a modified base, and/or a modified backbone, and/or a non-natural internucleoside linkage, or a combination of these modifications.”[36]
[35] The present application at page 23.
[36] ibid.
The specification states that one or more nucleotides of AON are modified to increase the resistance of the molecule to nuclease degradation or RNase H enzyme activity and increase the affinity of the AON for the target sequence.[37] The statements are consistent with reports in the Nature review and RNA article which state that chemical modifications to the nucleotides of AON alter the efficiency of inducing exon skipping by protecting the AON against enzyme degradation and increasing the affinity of the AON for the target sequence.[38]
[37] The present application at pages 23 and 25.
[38] Nature review at page 780; RNA article at pages 1618-1619. I note that RNase H is defined in the Nature review as an enzyme that cleaves RNA/DNA complexes.
The specification states that modified bases comprise synthetic and natural bases including derivatives of pyrimidine and purine bases that are known in the art.[39]
[39] The present application at page 26.
The specification also states modified backbones comprise phosphorodiamidate morpholino oligomers (morpholinos) which have previously been investigated as antisense agents.[40] A phosphorodiamidate morpholino backbone has a six membered morpholino ring and a phosphorodiamidate linkage instead of a deoxyribose sugar and a phosphodiester linkage of DNA.[41] Another example of a modified backbone is stated to comprise phosphorothioate (PS), a nucleotide analogue which has a sulphur atom substitution for one of the non-bridging oxygens in the phosphodiester linkage.[42]
[40] The present application at page 23.
[41] ibid.
[42] The present application at page 25.

The specification additionally states that chemical modifications to the sugar moiety of a nucleotide analogue are used to improve the resistance of the AON to nuclease degradation and increase the affinity of the AON for the target sequence.[43] For example, a sugar moiety can be substituted at the 2', 3' or 5' position, or be a derivative of ribose or deoxyribose.[44] A preferred modified sugar moiety is stated to be that of a Locked Nucleic Acid nucleotide analogue (LNA) in which the 2'-carbon atom is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.[45] The RNA article states that the link that connects the 2'-O to the 4'-C of the sugar ring forces the nucleotide into a particular conformation which results in the LNA being inflexible and having an extremely high affinity for RNA and DNA.[46] A conformational structure of an LNA is reproduced below.[47]
[43] ibid.
[44] ibid.
[45] ibid.
[46] RNA article at page 1619.
[47] The structure of LNA has been reproduced from a journal article cross-referenced in the RNA article. The citation details of the journal article are Obika, S. et al., “Stability and structural features of the duplexes containing nucleoside analogues with a fixed N-type conformation, 2′-O, 4′-C-methyleneribonucleosides”, Tetrahedron Letters, July 1998 , Volume 39, Issue 30, pages 5401-5404.
The RNA article states that different chemical modifications to the nucleotides of the AON have different characteristics.[48] The most commonly used chemical modifications are stated to be 2'-O-methyl or 2'-O-methoxyethyl RNA with a phosphorothioate backbone (2'-O-methyl PS).[49] Morpholinos and LNA are stated to be known alternative backbones.[50] I also note that the Nature review states that 2'-O-methyl PS, morpholinos, LNA and PNA (peptide nucleic acids) are alternative backbone modifications that were, by 2003, being evaluated for use in AONs.[51]
[48] RNA article at page 1618.
[49] ibid.
[50] RNA article at page 1619.
[51] Nature review at page 780; the present application states on page 24 that backbone of PNA is composed of N-(2-aminoethyl)-glycine units linked by peptide bonds, wherein the nucleobases are linked to the backbone by methylene carbonyl bonds.
I have previously discussed that I understand the specification to tell me that the skilled person would as a matter of course consider altering the AON chemistry when designing an AON. I infer from the specification, RNA article and Nature review that the use of 2'-O-methyl PS, morpholinos, LNA or PNA were commonly known alternative backbone modifications which were used as a matter of course when designing AONs at the priority date of the present application.
The RNA article also states that the optimal chemical modification of the AON is likely to be partly dependent on the target sequence.[52] As an example, it was stated that AON with LNAs were the most efficient chemical modifications for inducing exon 46 skipping, but AON with 2'-O-methyl PS backbone was optimal for inducing exon 51 skipping.[53] Based on an understanding that 2’-O-methyl PS, morpholinos, LNA and PNA are alternatives of a class of backbone modifications commonly known to the skilled person, I consider it would be reasonable to infer that the skilled person would as a matter of course try substituting one type of backbone modification for another when designing an AON with the optimal chemistry.
[52] RNA article at page 1619.
[53] ibid.
Sequence-specificity of the AON
The RNA article states that when the sequence-specificity of AONs having different chemical modifications—LNA, morpholino or 2'-O-methyl PS— were compared, it was reported that:[54]
·an AON with LNAs (LNA AON) which contains two mismatches within a span of 14 nucleotides was equally as efficient as a LNA AON without the mismatches in regard to exon skipping;
·AON with 2'-O-methyl PS was more sensitive to mismatches than LNA—a single mismatch either drastically decreases or completely abolishes the level of exon skipping ; and
·AON with morpholinos demonstrated mixed results in regard to efficiency of exon skipping.
[54] ibid.
I understand the term “mismatches” to mean changes to the nucleotide sequence of the AON such that some of the nucleotides of the AON do not form complementary pairs with the nucleotide sequence of the target exon. My understanding is consistent with statements in the present specification in regard to base pair complementarity and mismatches.[55]
[55] The present application at page 18.
I understand from the RNA article that LNAs can improve exon skipping efficiency when the sequence of the AON is not perfectly complementary to the target sequence. In other words, the presence of LNA in an AON can allow poorer sequence-specificity to be tolerated.
2.5 Examples of the invention
Example 1
Example 1 describes the design and synthesis of a series of AONs which target sequences within exon 44. The nucleotide sequences of these AONs are tabulated in Tables 1A and 1B which are reproduced in Annex A at the end of this decision. The AONs are stated to contain 2'-O-methyl RNA and full-length PS backbones.[56]
[56] The present application at page 40.
The series of AONs listed in Tables 1A and 1B were transfected into myotube cultures derived from a healthy individual (this being the “human control” culture) or a DMD patient with an exon 45 deletion.[57] The efficiency of exon 44 skipping was determined by RT-PCR analysis and sequence analysis was used to verify the identity of the isolated RNA.[58] The specification states that in myotubes derived from a DMD patient with a deletion of exon 45, specific exon 44 skipping was induced using 150 nM of the AON tested.[59] The AONs PS190 (stated as previously published as h44AON2 in the journal article by Aartsma-Rus et al., Neuromuscular disorders, 2002, Volume 12, Supplement, pages S71-S77), PS191 (SEQ ID NO: 47), PS193 (SEQ ID NO: 48), PS194 (SEQ ID NO: 46) and PS196 (SEQ ID NO:51) were stated to demonstrate the highest levels of skipping, these levels being between 84% and 94%.[60] The specification states that based on all transfection experiments, the AONs PS187, PS188, PS190, PS191, PS192, PS193, PS194, PS196 and PS200 were considered the most efficient.[61]
[57] ibid.
[58] The present application at pages 40-41.
[59] The present application at page 41.
[60] The present application at page 41 and Figure 1A.
[61] The present application at page 41.
PS188 (SEQ ID NO:5) was stated to be further tested in dose-dependent experiments in healthy human control muscle cells, and increasing levels of exon 44 skipping were reported on the application of increasing doses of PS188 from 50 to 400 nM.[62]
[62] The present application at page 42 and Figure 2A.
Example 2
Peripheral blood mononuclear cells (PB-MNCs) from a healthy control individual were transfected with PS188.[63] The specification states that despite the fact that dystrophin is only expressed at low levels in this type of cell, exon 44 skipping was clearly observed and the results indicate that PS188 is efficient in inducing exon 44 skipping from the DMD gene in vitro.[64]
[63] The present application at pages 39 and 42 and Figure 2B.
[64] ibid.
Example 3
Transgenic, “humanised” DMD (hDMD) mice were given intramuscular AON-injections and exon 44 skipping was analysed by RT-PCR analysis[65] A hDMD mice is stated to carry an integrated and functional copy of a full-length human DMD gene and is used to provide pre-clinical validation of targeting human DMD gene in a mouse experimental background.[66] The AONs injected are stated to be human-specific PS196 (SEQ ID NO: 51) and PS188 (SEQ ID NO: 5), both of which contain 2'-O-methyl modified ribose molecules and full-length PS backbones.[67] The mice were given two injections of 40μg at a 24 hour interval and the PS188-injected hDMD mice sacrificed 10 days after the last injection.[68] Muscle samples were isolated and analysed by RT-PCR and sequence analyses to determine whether or not exon 44 skipping had occurred.[69]
[65] The present application at pages 43-45.
[66] The present application at page 46.
[67] The present application at page 43.
[68] The present application at page 44.
[69] The present application at pages 44-45.
The results were stated to indicate that PS188 induced human exon 44 skipping in muscle tissues in vivo.[70] No exon 44 skipping was observed in control experiments which consist of non-treated hDMD muscle.
[70] The present application at page 47 and Figure 3A.
Example 4
The specification states that as part of toxicity studies on PS188, monkeys were administered 1-hour infusions (5 mL/kg/h) every fourth day for 29 days at a dose of 6mg/kg PS188 (SEQ ID NO: 5, 2'-O-methyl PS RNA).[71] The animals were sacrificed 96 hours after the last administration (day 33). Whole blood samples were collected from the animals, PB-MNCs isolated from the samples and used for RT-PCR and sequence analyses to determine whether or not exon 44 skipping had occurred. The results were stated to indicate that PS188 induce skipping of exon 44 in vivo. No exon skipping was observed in non-treated monkeys.
[71] The present application at pages 47-48 and Figure 3B.
2.6 The invention as claimed
As previously discussed, it is the amended claims as proposed and filed on 21 November 2017 that I must consider. All the claims are reproduced in Annex B at the end of this decision.
Claim 1
Claim 1 is the only independent claim. Claim 1 reads:
“An oligonucleotide, capable of inducing skipping of at least 30% of exon 44 of dystrophin pre-mRNA when tested in a muscle cell of a DMD patient using RT-PCR, having a length from about 18 to about 30 nucleotides, excluding a length of 24 nucleotides, which is an antisense oligonucleotide to SEQ ID NO. 1: (5'-GUGGCUAACAGAAGCU-3') and which comprises a nucleotide analogue being a LNA (locked nucleic acid).”
“capable of inducing skipping of at least 30% of exon 44 of dystrophin pre-mRNA when tested in a muscle cell of a DMD patient using RT-PCR”
Reading the words in the context in which they appear in the claim, the claimed oligonucleotide is capable of inducing skipping of exon 44. I have previously discussed that the term “splicing” is a technical term that is understood by the person skilled in the art to mean a process in which introns present in the pre-mRNA transcript are removed and exons joined together to form a mature mRNA. In the present claim the oligonucleotide is capable of inducing a process where exon 44 is not included in the dystrophin mature mRNA when introns in the dystrophin pre-mRNA are removed and exons are joined together. This process is schematically represented in a figure reproduced above.
The arrangement of the words in claim 1 indicates a level of exon 44 skipping that can be assessed in a muscle cell of a DMD patient using RT-PCR. A relevant question is whether the claim is defining that (1) exon 44 is not included in at least 30% of the total mature mRNA produced after splicing of the pre-mRNA has occurred, or (2) whether at least 30% of exon 44 is not included in the mature mRNA produced after splicing of the pre-mRNA has occurred.
The specification states that RT-PCR (Reverse Transcription Polymerase Chain Reaction) is a method of assessing the level of mRNA and therefore exon skipping efficiencies.[72] The specification also states that when tested in a muscle cell of a DMD patient by RT-PCR, the exon 44 skipping percentage is at least 30%.[73] I conclude that the interpretation that exon 44 is not included in at least 30% of the total mature mRNA produced after splicing of the pre-mRNA has occurred (option (1) mentioned above), is more consistent with the statement in the specification and what a person skilled in the art understands about the process of exon skipping. This is the way I understand the claim. However, it would be helpful if this was made explicit in the claim.
[72] The present application at pages 17, 19, 40 and 44-45.
[73] The present application at page 8.
“having a length from about 18 to about 30 nucleotides, excluding a length of 24 nucleotides”
A relevant consideration here is the scope of variation in length of the oligonucleotide encompassed by the term “about”. The specification states that when used in association with a numerical value, the term “about” means the numerical value may be the given value more or less 1% of that value.[74] As an oligonucleotide must be composed of whole nucleotides and not fractions thereof, I consider it would be reasonable to interpret the length of the claimed oligonucleotide to be, in effect, 18 to 30 nucleotides, excluding 24 nucleotides.
[74] The present application at page 37.
“antisense oligonucleotide”
The claim defines the claimed oligonucleotide to be an antisense oligonucleotide to SEQ ID NO. 1 (5'-GUGGCUAACAGAAGCU-3'). As discussed previously, the term “antisense oligonucleotide” is a technical term that the person skilled in the art would understand to be a nucleotide sequence that has complementary base pairs to the target sequence, in this case complementary sequences with SEQ ID NO. 1. Therefore, the sequence of an antisense oligonucleotide with perfect complementarity is 5'-AGCUUCUGUUAGCCAC-3'.
However, the specification states:
“Throughout this application, when the word oligonucleotide is used it may be replaced by a functional equivalent thereof as defined herein.”[75]
and
“Within the context of the invention, a functional equivalent of an oligonucleotide preferably means an oligonucleotide as defined herein wherein one or more nucleotides have been substituted and wherein an activity of said functional equivalent is retained to at least some extent. Preferably, an activity of said functional equivalent is providing a functional dystrophin protein. Said activity of said functional equivalent is therefore preferably assessed by quantifying the amount of a functional dystrophin protein or by quantifying the amount of a functional dystrophin mRNA.”[76]
[75] The present application at page 17.
[76] ibid.
The specification also states that the assessment of activity of the an oligonucleotide may be done by (1) RT-PCR, this being a method used to detect RNA expression and known to the skilled person, or (2) immunofluorescence or Western blot analysis, these being methods used to detect protein expression and known to the skilled person.[77]
[77] ibid.
Therefore, I interpret the scope of claim 1 to include an AON that has a sequence which is not perfectly complementary to SEQ ID NO. 1. In regard to the association between functionality and complementarity of the AON, the specification states that one or two or more mismatches may be allowed as long as the functionality, i.e. inducing skipping of exon 44, is still acceptable.[78] The specification also states:
“It is thus not absolutely required that all the bases in the region of complementarity are capable of pairing with bases in the opposing strand. For instance, when designing the oligonucleotide one may want to incorporate for instance a residue that does not base pair with the base on the complementary strand. Mismatches may, to some extent, be allowed, if under the circumstances in the cell, the stretch of nucleotides is sufficiently capable of hybridising to the complementary part. In this context, ‘sufficiently’ preferably means that using a gel mobility shift assay as described in example 1 of EP 1 619 249, binding of an oligonucleotide is detectable. Optionally, said oligonucleotide may further be tested by transfection into muscle cells of patients. Skipping of the targeted exon may be assessed by RT-PCR (as described in EP 1 619 249).”[79]
[78] The present application at page 5.
[79] The present application at page 18.
Therefore, I interpret the scope of claim 1 to include an AON that has mismatches with SEQ ID NO. 1 to an extent that the AON is capable of hybridising to a complementary sequence in exon 44 of dystrophin pre-mRNA and inducing skipping of exon 44 to the efficiency level recited in the claim. This level is assessed by testing a muscle cell of a patient using RT-PCR.
“comprises a nucleotide analogue being a LNA”
As previously discussed, LNA is a nucleotide analogue in which the 2'-carbon atom is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. Also as previously discussed, LNA (1) protects the AON against enzyme degradation and increases the affinity of the AON for the target sequence, (2) alters the binding specificity of the AON for the target sequence and (3) consequently, alters the efficiency of exon skipping.
A relevant question here is whether the indefinite article “a” means one and only one nucleotide analogue is a LNA, or whether “a” means at least one. Reading the words of claim 1 in context, and adopting a non-exhaustive meaning of the term “comprises”, I consider “a” means at least one. Additionally, the specification states:
“..‘a’…. does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article ‘a’ …. thus usually means ‘at least one’.”
I am satisfied that the scope of claim 1 includes an antisense oligonucleotide having at least one nucleotide analogue that is a LNA.
In summary, I interpret claim 1 is directed to an oligonucleotide with the following features:
·A capability to induce skipping of exon 44 of dystrophin pre-mRNA to an efficiency level such that exon 44 is not included in at least 30% of the total mature mRNA produced after splicing of the pre-mRNA has occurred;
·A length of 18 to 30 nucleotides but not a length of 24 nucleotides;
·A nucleotide sequence that is complementary to SEQ ID NO. 1 and includes mismatches with SEQ ID NO. 1 to an extent that the oligonucleotide is capable of hybridising to a complementary sequence in exon 44 of dystrophin pre-mRNA and inducing skipping of exon 44 to the level discussed above; and
·At least one nucleotide analogue that is a LNA.
Dependent claims
Claims 2-17 are appended (directly or indirectly) to claim 1. There are terms in some of these claims that are worth interpreting. I will now consider these terms.
Claim 4 reads:
“An oligonucleotide according to any one of claims 1 to 3 comprising at least two different types of nucleotide analogues.”
Claim 4 is appended to any one of claims 1 to 3 with the additional qualification that the oligonucleotide comprises at least two different types of nucleotide analogues. I have previously interpreted the antisense oligonucleotide of claim 1 to have at least one nucleotide analogue that is a LNA. It follows that the oligonucleotide of claim 4 comprises at least one LNA and at least one other type of nucleotide analogue that is different to LNA.
As discussed previously, the specification provides a dictionary meaning for the term “nucleotide analogue”, this being a DNA or RNA residue having a modified base, and/or a modified backbone, and/or a non-natural internucleoside linkage, or a combination of these modifications. I consider the term “nucleotide” would be understood by the skilled person to mean an organic molecule which forms the building block of nucleic acids, and is composed of three subunit molecules—a nitrogenous base, a five-carbon sugar (ribose or deoxyribose) and at least one phosphate group. The term “nucleoside” would be understood by the skilled person to mean a nucleotide without a phosphate group, that is, a nucleoside is composed of a nitrogenous base and a five-carbon sugar. I consider the term “backbone” would be understood by the skilled person to mean the phosphate group and sugar moiety of nucleic acid linked by a phosphodiester bond.
It follows that a “modified base” is a modified nitrogenous base, a “modified backbone” means modifications to a phosphodiester bond and/or sugar moiety of a nucleic acid, and a “non-natural internucleoside linkage” is a linkage between the sugar moieties of the nucleic acid that is not a phosphodiester bond. I understand phosphorothioate (PS) and phosphorodiamidate to be examples of a non-natural internucleoside linkage.

Therefore, the scope of the other type of nucleotide analogue that is different to LNA in claim 4 includes a LNA that has a modified base and/or a non-natural internucleoside linkage (herein referred to as a LNA+ analogue) and a nucleotide analogue with a modification to the nitrogenous base and/or sugar moiety and/or internucleoside linkage and does not have the sugar moiety of LNA (herein referred to as a non-LNA analogue).
Claim 5 reads:
“An oligonucleotide according to any one of claims 1 to 4 wherein the nucleotide analogue has a modified base and/or a non-natural internucleoside linkage or a combination of these modifications”
Claim 5 is appended to any one of claims 1 to 4 with the additional qualification that the nucleotide analogue has a modified base and/or a non-natural internucleoside linkage or a combination of these modifications.
A relevant consideration is the meaning of the term “the nucleotide analogue” in claim 5. I consider the scope of the term depends on the appendency of claim 5. When claim 5 is appended to claim 1, “the nucleotide analogue” refers to a LNA, and consequently the oligonucleotide includes a LNA which has a modified base and/or a non-natural internucleoside linkage (LNA+ analogue). When claim 5 is appended to claim 4 “the nucleotide analogue” refers to a LNA or a nucleotide analogue which does not have the sugar moiety of LNA (non-LNA analogue), and consequently the oligonucleotide includes (1) modifications to the base and/or non-natural internucleoside linkage of LNA (LNA+ analogue), (2) modification to the base and/or non-natural internucleoside linkage of a non-LNA analogue, or (3) a combination of LNA+ analogue and non-LNA analogue which has a modification to the base and/or non-natural internucleoside linkage.
I note that each of claims 6-12 is directly or indirectly appended to claim 5, and consequently each claim imports the features of claim 5 as discussed above.
Claim 14 reads:
“A pharmaceutical composition comprising an oligonucleotide according to any one of claim 1 to 13 and a pharmaceutical acceptable carrier.”
Claim 14 is appended to any one of claims 1 to 13 with the additional qualification that the oligonucleotide is part of a pharmaceutical composition. The Macquarie dictionary defines “pharmaceutical” as “an item, especially a medicine, sold at a pharmacy”.[80] Therefore, I interpret the composition of claim 14 to be a composition that is intended to be used as a medicine and comprises the oligonucleotide defined in the preceding claims in combination with a pharmaceutical acceptable carrier. “A pharmaceutical acceptable carrier” is a term that the person skilled in the art would understand to be a component of a pharmaceutical composition that functions to place the composition in a form suitable for administration. This interpretation is consistent with the specification which states that information about pharmaceutical acceptable carriers may be found in a reference such as Remington: The Science and Practice of Pharmacy, 20th Edition, Baltimore, MD: Lippincott Williams & Wilkins, 2000.[81]
[80] Macquarie Dictionary Publishers, 2017, Macmillan Publishers Australia 2018 (an online version).
[81] The present application at pages 33-34.
3. The grounds of objection
The most recent examination report dated 24 November 2017 raises two objections: manner of manufacture and inventive step. I will consider each of the grounds in turn.
3.1 Manner of Manufacture
The law
Subsection 18(1) of the Act relevantly reads:
Subject to subsection (2), an invention is a patentable invention for the purposes of a standard patent if the invention, so far as claimed in any claim:
(a) is a manner of manufacture within the meaning of section 6 of the Statute of Monopolies;
The classic definition of “manner of manufacture” is set out in National Research Development Corporation v Commissioner of Patents[82] (NRDC):
“The right question is: ‘Is this a proper subject of letters patent according to the principles which have been developed for the application of s. 6 of the Statute of Monopolies?’ ”[83]
[82] [1959] HCA 67; 102 CLR 252.
[83] NRDC at 269, [14].
The court then went on to set out a test in terms relevant to the facts of that case:
“a process, to fall within the limits of patentability which the context of the Statute of Monopolies has supplied, must be one that offers some advantage which is material, in the sense that the process belongs to a useful art as distinct from a fine art … that its value to the country is in the field of economic endeavour.”[84]
and
“The effect produced by the appellant's method exhibits the two essential qualities upon which ‘product’ and ‘vendible’ seem designed to insist. It is a ‘product’ because it consists in an artificially created state of affairs, discernible by observing over a period the growth of weeds and crops respectively on sown land on which the method has been put into practice. And the significance of the product is economic; for it provides a remarkable advantage, indeed to the lay mind a sensational advantage, for one of the most elemental activities by which man has served his material needs, the cultivation of the soil for the production of its fruits.”[85]
[84] NRDC at 275, [22].
[85] NRDC at 277, [25].
However, the High Court was not laying down a precise formulation that can be applied unthinkingly:
“This Court in NRDC did not prescribe a well-defined pathway for the development of the concept of ‘manner of manufacture’ in its application to unimagined technologies with unimagined characteristics and implications. Rather, it authorised a case-by-case methodology.”[86]
[86] D'Arcy v Myriad Genetics Inc [2015] HCA 35 (Myriad) at [23].
That case-by-case approach must have regard to the substance of the claimed invention, not simply the form of the claim.[87] The point is made most succinctly by Gageler and Nettle JJ in the Myriad case:
“Whatever words have been used, the matter must be looked at as one of substance and effect must be given to the true nature of the claim.”[88]
[87] Myriad at [6] and [88].
[88] Myriad at [144].
In the Myriad case, the majority found that although the claims were formulated as a class of product, the substance of the claims was information embodied in arrangements of nucleotides coding for the BRCA1 polypeptide.[89] The High Court found that the genetic information is not “made” by human action, but discerned, and therefore not “artificially created”.[90] The High Court also characterised cDNA, a form of nucleic acid that is synthesised in the laboratory but which replicates a naturally occurring sequence of exons, to be in substance genetic information.
[89] Myriad at [6] and [88]-[92].
[90] Myriad at [6] and [91].
The majority in the Myriad case stated:
“The code in the invention as claimed refers to the sequence of nucleotides which, in a cellular environment, can ultimately be translated into the BRCA1 polypeptide. That sequence can properly be described as ‘information’, the ordinary meaning of which includes:
‘Without necessary relation to a recipient: that which inheres in or is represented by a particular arrangement, sequence, or set, that may be stored in, transferred by, and responded to by inanimate things’.
Used in that sense, the information stored in the sequence of nucleotides coding for the mutated or polymorphic BRCA1 polypeptide is the same information as that contained in the DNA of the person from which the nucleic acid was isolated. It is the existence of that information which is an essential element of the invention as claimed. The product is the medium in which that information resides. That characteristic also attaches to cDNA, covered by the claims, which is synthesised but replicates a naturally occurring sequence of exons.”[91] [Emphasis added]
[91] Myriad at [89], the number referring to the footnote in the judgement has been removed. The footnote reads “Shorter Oxford English Dictionary, 5^th ed, 2002, vol 1, p 1371, ‘information’, sense 3(c).”
The High Court in the Myriad case found the focus of the claims in dispute was on genetic information.[92]
[92] Myriad at [90], [158] and [279]-[282].
The majority in the Myriad case adopted an approach that gave priority to the informational aspect embodied and conveyed by the nucleotide sequences because the utility of Myriad’s claims lay in the genetic information embodied and conveyed by the nucleotide sequences:
“There are perhaps two ways of looking at the role of genetic information in characterising the subject matter of the claims. One way is to say that the chemical formula of any given isolated nucleic acid is defined, in part, by the sequence of nucleotides which it reproduces and, in that sense, is defined by the information embodied in that sequence. Another way is to say that the particular chemical compound embodies and conveys the information. The latter approach gives the priority to the informational aspect which its importance to the utility of the claimed invention warrants.” [93]
[93] Myriad at [92], numbers referring to footnotes in the judgement have been removed.
Gordon J stated:
“As a matter of substance, each of claims 1–3 focuses on the existence of one or more elements of an identified code: a code which is found in the nucleic acid isolated from a patient and which necessarily must be identical to the coding sequence in that patient. None of the asserted chemical, structural and functional differences identified by the Full Court play any part in the definition of the invention ‘so far as claimed’ in each of claims 1–3 or in the description of the invention in the specification.”[94]
[94] Myriad at [279].
The High Court in Myriad did not have to consider claims to methods as the claims in issue were directed to a product—an isolated nucleic acid which has one or more specific mutations or polymorphisms in the BRCA1 gene.[95] However, Beach J in Meat & Livestock Australia Limited v Cargill, Inc[96] (MLA) considered whether or not claims directed to a method for identifying a trait of a bovine subject from a nucleic acid sample of the bovine subject were for a manner of manufacture. His Honour found the substance of the method claims is not genetic information but rather the practical application of the identification of single nucleotide polymorphisms (SNPs) from a nucleic acid sample of the bovine subject and their association with a trait of interest.[97]
[95] Myriad at [3].
[96] [2018] FCA 51; 129 IPR 278 at [409]-[516].
[97] MLA at [453].
Beach J acknowledged that SNPs are naturally occurring, and ascertaining the association of the occurrence of particular SNPs with a trait of interest involves making correlations from naturally occurring phenomena.[98] However, his Honour stated that the method claims are not directed to the SNPs or their association with the trait per se and it is impermissible to disregard the wording of the claims and diminish their formal content under the guise of having regard to the “substance” of what is claimed.[99] His Honour had previously observed that (1) each claim must be construed as a whole, (2) it is the integers of a claim considered in combination which determines the scope of the claim, and (3) it is the interaction between the integers to produce a new result that is the essence of the claimed invention.[100] His Honour stated the claims of the patent application in dispute, except one claim, were:
“directed to novel and inventive methods and processes as I have ultimately found, are within the plain vanilla concept of manner of manufacture as outlined in NRDC and Myriad.”[101]
[98] MLA at [454].
[99] ibid.
[100] MLA at [262].
[101] MLA at [428].
I will now outline two recent decisions by delegates of the Commissioner that applied the law as stated in Myriad to inventions relating to nucleic acids.
The delegate in Arrowhead Research Corporation (Arrowhead) considered claims directed to compositions comprising particular interfering RNA (iRNA) molecules and decided whether or not the substance of the claimed invention is genetic information.[102] The proper weighing up of considerations was explained by the delegate:
“… there is no suggestion that the inventive contribution resides in the tools or techniques used. Rather, the strong emphasis placed on the specific target sequences identified ….. suggests that the inventive contribution resides in the sequences themselves. Clearly, the information embodied in the arrangement of nucleotides within the target sequences is crucial to the invention and can be considered to support the examiner’s opinion that the substance of the invention is genetic information.”[103]
“… based on a consideration of how the invention works the substance of the claimed invention is more than genetic information alone. It is the interfering RNA molecules that target Syk mRNA and thereby interfere with Syk mRNA expression. These molecules are more than a ‘step along the way to an artificially created state of affairs of economic significance’ as described in Myriad at [85]: they are the invention described in the application. ...”[104]
“Having considered the inventive contribution of the claimed invention and the manner in which the invention works I have determined that the substance of the invention can be considered to be either genetic information or a pharmaceutical composition. On balance, I find the factors supporting the proposition that the substance of the invention is a pharmaceutical composition more persuasive. Accordingly, I consider the substance of the invention to be pharmaceutical composition not the genetic information that is contained in the composition.”[105]
[102] [2016] APO 70.
[103] Arrowhead at [23].
[104] Arrowhead at [29].
[105] Arrowhead at [30].
The delegate in Arrowhead considered how the invention worked and found the substance of the claimed compositions was a pharmaceutical composition, not genetic information, and therefore the claimed invention was directed to a manner of manufacture.[106]
[106] Arrowhead at [29]-[31].
The delegate in Cargill Incorporated v Dow AgroSciences LLC (Cargill) considered a claim directed to a polynucleotide comprising a nucleotide sequence which codes for a particular fungal gene and which has altered codons (nucleotide triplets).[107] Notwithstanding the claimed nucleotide sequence encodes for the same protein as the naturally-occurring fungal sequence, the delegate considered the altered codons claimed enhanced production of the fungal protein above that which could be expected from the naturally-occurring sequence.[108] This process of altering codons to improve protein production is termed codon optimisation. The delegate found that whilst the substance of the claim is genetic information embodied in the nucleic acid sequence, the genetic information was considered to have been modified due to codon-optimisation.[109] Therefore, the delegate found that the substance of the claimed invention is genetic information that was “made”, and the claimed invention was a manner of manufacture.[110]
[107] [2016] APO 43.
[108] Cargill at [43]-[44].
[109] Cargill at [44].
[110] Cargill at [45].
I conclude that the approach I am to take is to determine what is the substance of the claimed invention, and whether or not that substance has been “made”. I note that the substance of the claimed invention is not necessarily the subject matter of the claim as defined by the words of the claim.
In determining the substance of the invention, I am to consider:
·how the invention works;
othe nature and contribution of the nucleotide sequence to the working of the invention;
othe nature and contribution of the other claimed features to the working of the invention;
·the nature of the contribution to the art; and
·whether the nature and contribution of the features of the invention claimed as a whole, on balance, weigh towards being characterised as genetic information, or a chemical compound.
The objection
The examiner objected to claims 1-14 of the present application on the ground that each claim does not define a manner of manufacture within the meaning of s 18(1)(a) of the Act. The main points of the examiner’s objection on this ground are reflected in the following paragraphs:
“As previously stated, the current invention of claims 1-14 is directed to an oligonucleotide that hybridises to a native sequence in the pre-mRNA, thereby mis-directing the spliceosome to skip over that particular exon. It does not rely on its structural or chemical elements in order to initiate a cellular process; rather it masks the natural working of a cellular complex. It appears to achieve this through hybridisation of the claimed oligonucleotide to its pre-mRNA target. The genetic information of the claimed oligonucleotide alone is responsible for the hybridisation, and it is the hybridised complex that causes the spliceosome to skip, not the oligonucleotide alone. As such the substance of the claim is considered to be the genetic information that the claimed oligonucleotide encodes.
I note that the oligonucleotide is modified by the incorporation of an LNA molecule. However, this does not ‘make’ or change the genetic information that is the substance of the claim. Attorney’s arguments regarding LNA molecules are noted, however, they are not found persuasive. While such a modification may improve the longevity of the oligonucleotide in an organism or cell, or increase nuclease resistance, it does not seem from the specification as a whole that this aspect of the claimed invention is integral to its working. Therefore, the modification of the oligonucleotide is not considered to move the substance of the invention towards being more than the genetic information of the oligonucleotide.
It appears that since the molecule of the invention is intended to hybridise to a natural piece of pre-mRNA and no alteration of the oligonucleotide sequence compared to the target sequence is claimed, the genetic information can not [sic] be considered to be ‘made’.
….
[111] The examiner’s most recent examination report dated 24 November 2017.
…. The genetic information of the present invention is considered to have a natural counterpart, as the oligonucleotide is the complement of the natural dystrophin gene, and as discussed above, the claim is considered to be genetic information and not a product.”[111]
The applicant’s submissions
The main points of the applicant’s written submissions filed in relation to the ground of manner of manufacture are reflected in the following paragraphs:
“… Properly construed, claim 1 is directed to a product, which is an oligonucleotide comprising a LNA, which by definition is artificial, the oligonucleotide possessing capability of inducing a minimum level of exon-skipping activity. That is, claims 1 to 13 are directed to a non-naturally occurring product for use in therapy.
The applicant does not disagree with the examiner’ s [sic] characterisation of the invention as claimed in objection 8, paragraph 2 insofar as the examiner describes the invention as claimed in the following terms:
[T]he current invention of claims 1-14 is directed to an oligonucleotide that hybridises to a native sequence in the pre-mRNA, thereby mis-directing the spliceosome to skip over that particular exon…It appears to achieve this through hybridisation of the claimed oligonucleotide to its pre-mRNA target.
However, the applicant does disagree with the examiner’ s [sic] statement that the invention as claimed:
does not rely on its structural or chemical elements in order to initiate a cellular process; rather it masks the natural working of a cellular complex.
This appears to be an illogical and artificial distinction. Instead, the applicant submits that the relevant factor is that the invention as claimed, in use, affects a biological process and produces a therapeutic benefit. In other words, it is irrelevant for the consideration of patentable subject matter whether or not the invention as claimed inhibits or promotes a biological process.
Further, and as noted above, the applicant disagrees with the examiner’ s [sic] assertion in objection 8, paragraph 3, that a LNA is not relevant to the invention as claimed. Conversely, as acknowledged by the examiner, the applicant submits that a LNA increases nuclease resistance and/or hybridisation affinity, improving the exon-skipping activity while rendering it, by definition, non-natural.
Further again, and as noted in the response to the first examination report, the oligonucleotide as claimed is not synthesised in any known natural process (even without a LNA). That is, to the best of the applicant’ s [sic] knowledge, the corresponding genomic sequence confers no expression and ‘naturally occurring gene products’ as referred to by the examiner do not exist.” [112]
and
“… the substance of the claim does not reside in the information embodied in the sequence of nucleotides of the molecule, but rather in bringing into existence the oligonucleotide as claimed, the exon 44-skipping function of the oligonucleotide as claimed, and further improvement in exon 44-skipping function by incorporating a LNA into the oligonucleotide as claimed.”[113]
[112] The applicant’s written submissions dated 29 January 2018 at [18]-[22].
[113] The applicant’s written submissions dated 29 January 2018 at [43].
The subject matter of the claim

I have previously found claim 1 to define an oligonucleotide with (1) a particular nucleotide sequence which includes mismatches to an extent that the oligonucleotide is capable of hybridising to a complementary sequence in exon 44 of dystrophin pre-mRNA and inducing exon 44 skipping to an efficiency level as recited in the claim, (2) a particular length, and (3) at least one nucleotide analogue that is a LNA. Therefore, the subject matter of claim 1 is an oligonucleotide with the mentioned features.
I have also previously found claim 14 to define a composition that is intended to be used as a medicine and the composition comprises the oligonucleotide defined in the preceding claims in combination with a pharmaceutical acceptable carrier. Therefore, the subject matter of claim 14 is a composition with the mentioned features.
Since incorporating LNA into the claimed oligonucleotide is a chemical modification that requires human intervention, I acknowledge that the subject matter of claim 1 is an artificially made chemical compound. I accept the applicant’s submissions that the oligonucleotide is a non-naturally occurring product for use in therapy to the extent that the characterisation relates to the subject matter of claim 1. However, it does not necessarily follow that where the subject matter of a claim is an artificially made chemical compound, the substance of the claimed invention is not genetic information and consequently a manner of manufacture. It also does not necessarily follow that where the subject matter of a claim is a pharmaceutical composition, the substance of the claimed invention is not genetic information and consequently a manner of manufacture. This is because consideration must be given to the true nature of the claim, and not simply the form of the claim.
How does the claimed invention work?

100. A determination of the substance of a claimed invention requires consideration of how the claimed invention works. In considering how the invention works, I must consider the nature and contribution of the features of the invention claimed as a whole, not just the individual parts.
The nature and contribution of the specific nucleotide sequence to the working of the invention
101. As previously discussed, antisense oligonucleotides (AONs) are used to interfere with nucleotide sequences that are required for exon splicing (that is, block splicing signals) and, by doing so, induce exon skipping.
102. The use of AON to block splicing signals (which are themselves nucleotide sequences) and thereby induce exon skipping relies on the oligonucleotide having a capability to hybridise, or bind, by forming base pairs with a complementary sequence in the target exon (exon 44). Whilst the AON can include a level of mismatches with the target sequence, as previously discussed, recognition of a target sequence in exon 44 by the AON is required for binding of the AON. Therefore, the binding of the AON of claim 1 to the target sequence in exon 44 uses information embodied in the specific nucleotide sequence of the AON.
103. In the facts of the present case, the specific nucleotide sequences are used to sterically block splicing signals, induce exon 44-skipping and as a result increase the production of a partially functional dystrophin protein and/or decrease the production of an aberrant or less functional dystrophin protein in a cell. The consequence of the production of altered levels of partially functional dystrophin protein and/or less functional dystrophin protein is the alleviation of one or more symptoms of DMD or BMD.[114]
[114] The present application states on page 14 that alleviation of one or more symptoms of DMD or BMD may be assessed by assays that are known to the skilled person. Examples of such assays are those which assess improvement of muscle strength, improvement in ability to lift weight, improvement in pulmonary function and improvement in cardiac function.

104. The information in the partially functional dystrophin protein (altered protein) is not the same as the information embodied in the specific nucleotide sequence of an AON. I note that the pre-mRNA to which the AON binds contains exon 44 while the mature mRNA (produced after splicing pre-mRNA) lacks exon 44. The mature mRNA, with the “skipped” exon 44, is translated into the altered protein. It is the combination of the AON and the normal spliceosomal complex that leads to the production of the altered protein. The information embodied in the specific nucleotide sequence of an AON of the present invention is not a genetic code that is ultimately translated into an expressed polypeptide, but rather the nucleotide sequence is used to effect the production of an altered protein to a level not normally present in DMD or BMD patients. I consider the manner in which the information embodied in the specific nucleotide sequence of an AON is used, and the result of that use, resembles that of a chemical compound.
105. Additionally, the information embodied in the sequence of the claimed oligonucleotide is not used to ascertain information about a nucleic acid sequence, for example, identification of a mutation or polymorphism in a gene associated with a genetic disorder. In fact, in the present case, the genetic defects in the DMD gene are known.
106. I acknowledge that the claimed oligonucleotide uses the information embodied in a specific nucleotide sequence and, in some embodiments, the information corresponds to that contained in genomic DNA. However, because the contribution of the specific nucleotide sequence towards the working of the present invention lies in how the nucleotide sequence is used and the result of that use, I consider the contribution of the nucleotide sequence, on balance, weighs towards the substance of the claimed invention being a chemical compound.
The nature and contribution of the other claimed features to the working of the invention
107. As previously discussed, the specification states that the skilled person would know that the parameters available for optimising an AON for inducing exon skipping are (1) varying the length of the AON, (2) choosing a distinct stretch within the target exon to which the AON binds, (3) altering the chemical make-up of the AON, or (4) a combination of these parameters. I understand that varying the length of the AON contributes to optimising the binding kinetics, and consequently the exon skipping efficiency, of the AON.
108. I have previously discussed that LNA alters the efficiency of inducing exon skipping by protecting the AON against enzyme degradation, and increasing the affinity of the AON for the target sequence. I also previously discussed that LNA enables poorer sequence-specificity between an AON and the target sequence to be tolerated. Therefore, I consider LNA is a chemical modification which contributes to improving (1) the availability of the AON by improving the resistance of the AON to enzymatic degradation, and (2) the binding capacity of the AON.
109. I consider the structural features of length and presence of LNA of the claimed oligonucleotide are significant to the working of the invention, and weigh towards the substance of the claimed invention being a chemical compound.
What is the nature of the contribution to the art?
110. Another consideration in determining the substance of the invention is the nature of the contribution to the art of the invention.
111. As discussed previously, antisense-mediated exon skipping transforms out-of-frame mutations in DMD sufferers into in-frame BMD-like mutations that result in synthesis of partially functional dystrophin which will prolong the viability of muscles.
112. The oligonucleotide of the present invention induces exon 44-skipping and results in the production of an altered, but partially functional, dystrophin protein to a level not normally present in DMD or BMD patients. Put another way, the oligonucleotide effects the production of a partially functional dystrophin protein so that one or more symptoms of DMD or BMD is alleviated. Therefore, administration of the oligonucleotide produces a state in the cells of DMD or BMD patients which is artificial in the context of those patients.
113. Consequently, I conclude the nature of the contribution to the art is an oligonucleotide that induces exon 44-skipping to produce an altered, but partially functional, dystrophin protein to a level not normally present in DMD or BMD patients.
The substance of the invention
Claim 1
114. In the facts of the present application, I have found:
·The claimed oligonucleotide uses information embodied in the specific nucleotide sequence for binding to a target sequence in exon 44;
·The information embodied in the specific nucleotide sequence, in some embodiments, corresponds to that contained in genomic DNA;
·The specific nucleotide sequences are used to sterically block splicing signals, induce exon 44-skipping and as a result alter the levels of a partially functional dystrophin protein and/or a less functional dystrophin protein in a cell;
·The information embodied in the specific nucleotide sequences is not a genetic code that is ultimately translated into an expressed polypeptide, but rather the nucleotide sequences are used to effect the production of an altered, but partially functional, protein to a level not normally present in DMD or BMD patients;
·The information in the altered, but partially functional, dystrophin protein is not the same as the information embodied in the specific nucleotide sequences of the claimed oligonucleotide;
·The information embodied in the specific nucleotide sequences of the claimed oligonucleotide is not used to ascertain information about a nucleic acid sequence; and
·The length and presence of LNA of the claimed oligonucleotide are structural features that are significant to the working of the invention.

115. I note that in determining the substance of the claimed invention, I must consider the nature and contribution of the features of the invention claimed as a whole. No single consideration is conclusive in determining the substance of the claimed invention. Some considerations may be more significant than others.
116. In the facts of the present case, I consider the manner in which the information embodied in the specific nucleotide sequence is used, and the result of that use, to be significant considerations in determining the substance of the claimed invention. I have previously discussed that even though the specific nucleotide sequences of the claimed oligonucleotide do, in some instances, embody information that corresponds to that contained in genomic DNA, the manner in which the information is used in the working of the present invention and the result of that use weighs towards the substance of the claimed invention being a chemical compound.

117. I have also previously discussed that the length and presence of LNA of the claimed oligonucleotide are structural features that are significant to the working of the present invention. I note that the presence of LNA and/or a variation in the length of an oligonucleotide is not sufficient, in itself, to conclude that the substance of the claimed invention is a chemical compound.

118. Evaluating the nature and contribution of the features of the invention claimed as a whole, on balance, I consider the informational aspect of the claimed oligonucleotide of claim 1 does not outweigh its form as a chemical compound. I conclude that the substance of the claimed invention is an artificially made chemical compound. Consequently, I conclude that the oligonucleotide claimed in claim 1 is a manner of manufacture within the meaning of s 18(1)(a) of the Act.
Claims 2-13
119. Claims 2-13 are ultimately dependent on claim 1 with additional qualifications in relation to length, specific nucleotide sequences and the types of chemical modifications to the nucleotides of the oligonucleotide. For similar reasons as discussed for claim 1, I consider, on balance, the informational aspect of the claimed oligonucleotide of each of claims 2-13 does not outweigh its form as a chemical compound. I conclude the substance of the claimed invention of each of claims 2-13 is an artificially made chemical compound. Consequently, I conclude that the oligonucleotide claimed in each of claims 2-13 is a manner of manufacture within the meaning of s 18(1)(a) of the Act.
Claim 14
120. As discussed previously, claim 14 is directed to a pharmaceutical composition comprising an oligonucleotide according to any one of claims 1-13 and a pharmaceutical acceptable carrier. I also previously discussed that the carrier functions to place the composition in a form suitable for administration. I consider, on balance, the informational aspect of the claimed pharmaceutical composition does not outweigh its form as a chemical compound. I conclude the substance of the claimed invention of claim 14 is an artificially made chemical compound. Consequently, I conclude that the pharmaceutical composition claimed in claim 14 is a manner of manufacture within the meaning of s 18(1)(a) of the Act.
Claims 15-17
121. The ground of lack of manner of manufacture was not raised by the examiner in relation to claims 15-17. Therefore, I do not have to decide what the substance of each of the claimed inventions is. I will note that when determining the substance of method claims, the considerations discussed above would similarly apply.
Conclusion on manner of manufacture
122. I conclude that each of claims 1-14 is for a manner of manufacture within the meaning of s 18(1)(a) of the Act.
3.2 Inventive step
The law
123. It is a requirement of subsection 18(1) of the Act that the invention, so far as claimed in any claim, involves an inventive step. Subsection 7(2) states that an invention is taken to involve an inventive step unless it would have been obvious to a person skilled in the art in the light of the common general knowledge, considered alone or together with the prior art:
For the purposes of this Act, an invention is to be taken to involve an inventive step when compared with the prior art base unless the invention would have been obvious to a person skilled in the relevant art in the light of the common general knowledge as it existed (whether in or out of the patent area) before the priority date of the relevant claim, whether that knowledge is considered separately or together with the information mentioned in subsection (3).

124. Subsection (3) prescribes the information that may be considered as:
The information for the purposes of subsection (2) is:
(a) any single piece of prior art information; or
(b) a combination of any 2 or more pieces of prior art information that the skilled person mentioned in subsection (2) could, before the priority date of the relevant claim, be reasonably expected to have combined.

125. Once the common general knowledge (CGK) and relevant information have been identified, the test for whether an invention is obvious is to ask whether it would have been a matter of routine to proceed to the claimed invention. In Wellcome Foundation Ltd v V.R. Laboratories (Aust.) Pty Ltd Aickin J stated:
“The test is whether the hypothetical addressee faced with the same problem would have taken as a matter of routine whatever steps might have led from the prior art to the invention, whether they be the steps of the inventor or not.”[115]
[115] [1981] HCA 12 at [45]; 148 CLR 262 at 286.

126. The High Court in Aktiebolaget Hassle v Alphapharm Pty Ltd. (Alphapharm) approved this approach.[116] Matters of routine are to be distinguished from other courses of action:
[116] [2002] HCA 59; 212 CLR 411.
“The tracing of a course of action which was complex and detailed, as well as laborious, with a good deal of trial and error, with dead ends and the retracing of steps is not the taking of routine steps to which the hypothetical formulator was taken as a matter of course.” [117]
[117] Alphapharm at [58].

127. The High Court in Alphapharm also approved the use of the “Cripps question”:
“Would the notional research group at the relevant date, in all the circumstances, which include a knowledge of all the relevant prior art and of the facts…. directly be led as a matter of course to try [the claimed combination] in the expectation that it might well produce a [useful or better result]?” [118] (emphasis in the original)
[118] Alphapharm at [53].

128. Where the invention involves a combination of integers, obviousness is to be determined by reference to the combination as a whole and not each integer individually. As stated in Alphapharm:
“The claim is for a combination, the interaction between the integers of which is the essential requirement for the presence of an inventive step. It is the selection of the integers out of ‘perhaps many possibilities’ which must be shown by Alphapharm to be obvious, bearing in mind that the selection of the integers in which the invention lies can be expected to be a process necessarily involving rejection of other possible integers.”[119]
[119] Alphapharm at [41].

129. CGK is the background knowledge and experience available to all those working in the relevant art:
“The notion of common general knowledge itself involves the use of that which is known or used by those in the relevant trade. It forms the background knowledge and experience which is available to all in the trade in considering the making of new products, or the making of improvements in old, and it must be treated as being used by an individual as a general body of knowledge.”[120]
[120] Minnesota Mining and Manufacturing Co v Beiersdorf (Aust) Ltd [1980] HCA 9 at [115]; 144 CLR 253 at page 292.

130. It is not enough that information is recorded in a document, even one that is widely circulated. It is only part of the CGK when it is generally known and accepted.[121]
[121] Ranbaxy v AstraZeneca [2013] FCA 368; 101 IPR 11 at [217].
The objection
131. The examiner objected to claims 1-17 of the present application on the ground that each claim does not involve an inventive step in light of the following citation:
Wilton, S. D., et al., “Antisense Oligonucleotide-induced Exon Skipping Across the Human Dystrophin Gene Transcript”, Molecular Therapy, July 2007, Volume 15, pages 1288-1296 (herein referred to as the Wilton article).
132. The Wilton article is referred to as D1 in the examiner’s objection. The objection reads as follows:
“D1 discloses exon skipping of the human dystrophin gene, and discloses many oligonucleotides that achieve this function across various exons of the gene, and discloses the addition of modified bases for increasing stability. The specific sequence of H44A(+61+84) UGUUCAGCUUCUGUUAGCCACUGA (see page 1291, Table 1) is specifically disclosed. The oligonucleotides of the present invention can be considered as mere alternatives, and as stated in the first and second exam reports, it is not considered inventive to create a panel of oligonucleotides around the same core sequence with varying lengths; this would be done as a matter of routine by any person skilled in the art. The Attorney argues that the oligonucleotide of the present invention has been demonstrated to be highly efficient in inducing exon skipping. However, this argument stands only for a select few oligonucleotides, and especially the oligonucleotide of SEQ ID NO 5. It is considered that there is no special effect associated with the core sequence of SEQ ID NO 1, as various of the oligonucleotides with this core sequence have highly variable levels of inducing exon skipping as seen in present figures 1A and 1B for example. Therefore, there is no common surprising feature associated with the core sequence of SEQ ID NO 1, and not all oligonucleotides using this core sequence will have exceptional or unexpected exon skipping abilities.

The addition of the feature ‘at least 30% of exon 44’ does also not add any inventive merit. D1 states at page 1293, left hand column, final paragraph, that Type 1 exons only yield subtle improvements in optimisation, whereas type 2 and 3 are anticipated to yield substantial improvements. Exon 44 is classified as a type 2 exon, and as such it is indicated to optimise this exon further to create a better oligonucleotide with improved exon skipping efficiency. The person skilled in the art would be motivated by this to optimise the oligonucleotides for exon 44 skipping based on the H44 molecule defined in D1, which is antisense to present SEQ ID NO. 1, and only differs from the present invnetion [sic] by being 24 nucleotides in length. It is also noted that the ‘at least 30%’ of the present claims still overlaps with the classification in D1 of ‘medium’ exon skipping efficiency, as D1 classes ‘medium’ to be 10-30%.”[122]
[122] The examiner’s most recent examination report dated 24 November 2017.

The applicant’s submissions
133. The main points of the applicant’s written submissions filed in relation to the ground of inventive step are reflected in the following paragraphs:
“The applicant reiterates its position detailed in the response to the second examination report. The examiner alleges that the claims do not involve an inventive step in light of D1, as the claims would be construed as the capability of inducing any amount of exon skipping. The invention as claimed is restricted to oligonucleotides that induce skipping of exon 44 with an efficiency of at least 30%. The oligonucleotides of the present invention are highly efficient, whereas the oligonucleotide for skipping exon 44 disclosed in D1 H44A(+61+84) has not been classified as highly efficient, but as type 2/“medium” functional (page 1289, left column, last paragraph). Therefore, the applicant submits that a person skilled in the art would not be motivated to use or modify the oligonucleotide of D1 for skipping exon 44.
Finally, perhaps less importantly with respect to exon skipping efficiency, the examiner asserts at objection 9, paragraph 3 that:
D1 classes “medium” to be 10-30%.

However, this mischaracterises the disclosure of D1, which in fact characterises ‘medium’ as “between 10 and 30%” (emphasis added; D1 at page 1289, column 1, last line), i.e. 11 to 29%. Contrary to the examiner’ s assertion, “at least 30%” does not overlap with 11 to 29%.
Therefore, the person skilled in the art would not at the relevant date in all the circumstances directly be led as a matter of course to try the invention claimed in the expectation that it might well produce a useful desired result. Therefore, the invention as claimed is inventive over D1.”[123] (emphasis in the original)
[123] The applicant’s written submissions dated 29 January 2018 at [64]-[66].

The problem
134. The problem addressed by the present application is providing a method of treating DMD or BMD patients by inducing skipping of exon 44 of the DMD gene.
Obviousness
135. Before commencing my analyses on the ground of inventive step, I note, as previously discussed, I have drawn on the description in the present specification, RNA article and Nature review, which were cited in the specification and incorporated by reference, to inform me of what was commonly known and used as a matter of course by the skilled person at the priority date of the present application in regard to antisense-mediated exon skipping.
Wilton article (D1)
136. The examiner found each of claims 1-17 of the present application does not involve an inventive step in light of the Wilton article (D1) considered together with the CGK.
137. D1 was published in July 2007 and therefore is part of the prior art base.
138. D1 discloses the use of AONs to induce exon skipping across the human dystrophin pre-mRNA. D1 discloses a panel of AONs designed to induce skipping of every exon with the exception of the first and last exons. D1 states that 470 AONs consisting of 2’-O-Methyl modified bases on a phosphorothioate backbone (2’-O-methyl PS) were prepared to target sequences in exons predicted to be involved in processing dystrophin pre-mRNA. The AONs were transfected into muscle cells obtained from patients by an in vitro method and exon skipping efficiency was analysed in the transfected cells. D1 reports the AONs that are found most effective at inducing exon removal. Table 1 of D1 lists some of these AONs and classifies the AONs according to exon skipping efficacy based on the level and manner in which the exon can be excised from the mature mRNA.
139. Table 1 discloses an AON named H44A(+61+84) which induces skipping of exon 44. H44A(+61+84) has 24 nucleotides and the following sequence:
5’ UGU UCA GCU UCU GUU AGC CAC UGA 3’
140. Exon 44 has been classified by the authors of D1 to be a Type 2 exon.[124] An exon which is of a “high” (Type 1), “medium” (Type 2) or “low” (Type 3) classification can be removed from the dystrophin mRNA for, respectively, greater than 30%, between 10 and 30%, or less than 10% of the dystrophin pre-mRNA.[125] D1 also states that the authors anticipate that further optimisation of AON design will allow substantial improvements to allow reclassification of the Type 2 and 3 exons.[126] In other words, further optimisation of the AON will allow greater exon skipping efficacy for an exon which has been characterised as “medium” or “low”. I understand this to include optimising H44A(+61+84) for exon-44 skipping to an efficiency greater than 30%.
[124] Wilton article, Table 1 at pages 1290-1291.
[125] Wilton article, page1289.
[126] Wilton article, page 1293.
141. D1 discloses that the length of the AON is an important factor for refinements in the design of the AON during development and optimisation of AONs for inducing exon skipping.[127] I also note that the AONs in Table 1 are of different lengths. Therefore, I consider D1 explicitly teaches varying the length of an AON, including that of H44A(+61+84), is an important consideration for optimising exon skipping efficiency.
[127] ibid.
142. D1 states that the AONs were designed to induce exon skipping and for administration to individuals with DMD.[128]
[128] Wilton article, page 1294.
Claim 1
143. The differences between the disclosure in D1 and claim 1 of the present invention relate to the length and chemical modification of H44A(+61+84). The oligonucleotide of claim 1 has an LNA and excludes an oligonucleotide with a length of 24 nucleotides.
144. The relevant question here, for assessing obviousness, is whether the skilled person, at the priority date of the present application, would in all circumstances directly be led as a matter of course to try substituting LNA for 2’-O-methyl PS, and varying the length of H44A(+61+84) in the expectation that it might well produce an AON for a method of treating DMD or BMD patients by inducing skipping of exon 44 of the DMD gene.
145. As previously discussed, 2’-O-methyl PS, LNA, morpholinos and PNA are alternative members of a class of backbone modifications which were commonly known and used as a matter of course by the skilled person when designing AONs at the priority date of the present application. I also previously discussed that the skilled person would as a matter of course substitute one type of backbone modification for another when designing an AON with optimal chemistry. Therefore, it seems reasonable to infer that the skilled person would as a matter of course try substituting LNA for 2’-O-methyl PS in H44A(+61+84). My conclusion is consistent with how the present application describes chemical modifications of the nucleotides.
146. As discussed previously, the AONs of all the examples, including those listed in Tables 1A and 1B, have 2’-O-methyl PS. The present specification mentions LNA only once, and this is in the context of LNA being a preferred derivatized sugar moiety.[129] I consider this brief mention of LNA to mean that the applicant considers that the skilled person knows they can readily substitute 2’-O-methyl PS with LNA, even in the absence of a worked example, and expect to produce an AON for a method of treating DMD or BMD patients by inducing skipping of exon 44 of the DMD gene.
[129] The present application at page 25.
147. However, if the skilled person would not as a matter of course try substituting LNA for 2’-O-methyl PS when optimising an AON, then it may mean that any claim of the present application directed to an oligonucleotide having LNA lacks support. As I do not need to decide on the requirement of support in the matters before me, this issue will not be considered further.
148. As previously discussed, the specification states that when designing an AON the skilled person would as a matter of course optimise the AON by varying the AON length, choice of nucleotide sequences to which the AON would bind in the target exon, AON chemical make-up, or a combination of the mentioned parameters. It follows that the skilled person would as a matter of course vary a combination of the backbone modification and length of H44A(+61+84) when optimising an AON for inducing exon 44-skipping at the priority date of the present application.
149. I will now address the capability of the resulting AON to induce exon 44-skipping to an efficiency where exon 44 is not included in at least 30% of the total mature mRNA produced after splicing of the pre-mRNA has occurred. Once an AON has been prepared, it is inevitable that it would be tested to determine the efficiency of exon skipping. A skilled person would inevitably choose those AONs with an effective efficiency.
150. Consequently, I consider the skilled person would in all circumstances directly be led as a matter of course to substitute LNA for 2’-O-methyl PS, and vary the length of H44A(+61+84), in the expectation that it might well produce an AON capable of inducing exon 44-skipping to the level as recited in claim 1.
151. Therefore, I conclude that claim 1 lacks an inventive step in light of the Wilton article (D1) considered together with the CGK.
152. I will now consider the claims appended to claim 1.
Claims 2-17
153. Claim 2: Claim 2 is appended to claim 1 with the additional qualification that the oligonucleotide is of a defined length. I have previously discussed that the length of an AON is known to the skilled person as a parameter that would be varied as a matter of course to optimise an AON for enhancing exon skipping. Consequently, I conclude that claim 2 lacks an inventive step in light of D1 considered together with the CGK.
154. Claim 3: Claim 3 is appended to claim 1 or claim 2 with the additional qualification that the oligonucleotide comprises or consists of SEQ ID NO: 5, 49 or 54. For convenience, I reproduce the claimed nucleotide sequences here and align the common nucleotide sequences shared with those of H44A(+61+84) or the complementary sequence to SEQ ID NO: 1 of claim 1:
Complementary sequence to SEQ ID NO: 1 5'-A GCU UCU GUU AGC CAC-3'
H44A(+61+84)   5’-UGU UCA GCU UCU GUU AGC CAC UGA
SEQ ID NO: 5   5’-UCA GCU UCU GUU AGC CAC UG
SEQ ID NO: 49   5’-GUUCA GCU UCU GUU AGC C
SEQ ID NO: 54   5’-UCU GUU AGC CAC UGA UUA AAU
155. As can be seen from the alignment of the sequences, SEQ ID NO: 5 and 49 are shorter in length compared to H44A(+61+84) and have nucleotide sequences that are a subset of those of H44A(+61+84). SEQ ID NO: 54 is also shorter compared to H44A(+61+84), has certain nucleotides that are present in H44A(+61+84) and has certain other nucleotides that are not present in H44A(+61+84).
156. The relevant question here is whether the skilled person, at the priority date of the present application, would in all circumstances directly be led as a matter of course to try substituting LNA for 2’-O-methyl PS in H44A(+61+84) and vary the choice of nucleotide sequences to which the AON would bind in the target exon in the expectation that it might well produce an AON for a method of treating DMD or BMD patients by inducing skipping of exon 44 of the DMD gene.
157. I have used the nucleotide sequences of H44A(+61+84), the reverse complement of SEQ ID NO: 1, and the nucleotide sequences of SEQ ID NO: 5, 49 and 54 to locate where these AONs would bind in the wild type human dystrophin. The amino acid sequence of wild type human dystrophin is represented by SEQ ID NO: 55 and is shown on pages 50 and 51 of the specification. I have found the mentioned AONs to bind to nucleotides that encode the following amino acid sequences in SEQ ID NO: 55:
H44A(+61+84)  QWLTEAE
Reverse complement of SEQ ID No: 1   WLTEA
SEQ ID NO: 5   QWLTEA
SEQ ID NO: 49  LTEAE
SEQ ID NO: 54  FNQWLT
158. Line 41 on page 50 of the specification shows that SEQ ID NO: 55 has a portion with the amino acid sequence “…..FNQWLTEAE…..”. It is clear that each of the AONs listed above has been designed to bind to nucleotide sequences of dystrophin pre-mRNA in the vicinity of a region which corresponds to the region encoding FNQWLTEAE in the dystrophin protein. It is clear from the comparisons made above that the nucleotides changes that result in an AON comprising or consisting of SEQ ID NO: 5, 49, and 54 are not random but, in fact, nucleotide changes that a skilled person would choose since these are nucleotides within dystrophin pre-mRNA that correspond to specific amino acid sequences encoded by the dystrophin protein.
159. As previously discussed, the specification states that when designing an AON the skilled person would as a matter of course (a) choose an AON that is able to bind a particular sequence of the target exon, and (b) optimise the AON by varying the AON length, choice of nucleotide sequences to which the AON would bind in the target exon, AON chemical make-up, or a combination of the mentioned parameters.
160. It follows that an oligonucleotide comprising or consisting of SEQ ID NO: 5, 49 or 54 and having an LNA would be arrived at as a matter of course when the skilled person varies a combination of the backbone modification of H44A(+61+84) and the choice of nucleotide sequences in the target exon when optimising an AON for inducing exon 44-skipping. Consequently, the claimed oligonucleotide of claim 3 lacks an inventive step in light of D1 considered together with the CGK.
161. Claim 4: I have previously construed claim 4 to include LNA and a nucleotide analogue that is different to LNA. The nucleotide analogue that is different to LNA includes LNA+ analogue and non-LNA analogue.
162. I have previously mentioned that the specification states that modified bases are known in the art. I have also previously discussed that 2'-O-methoxyethyl PS, morpholinos, LNA and PNA are commonly known backbone modifications which were used as a matter of course by the skilled person when designing an AON for exon skipping. However, the present specification and review articles incorporated by reference do not establish that the skilled person would as a matter of course use LNA in combination with LNA+ or non-LNA analogues when designing an AON for exon skipping. It may be the case that the use of LNA in combination with LNA+ or non-LNA analogues when designing AON for exon skipping was done as a matter of course by the skilled person at the priority date of the present application. In order to establish this, further searching of the prior art may need to be conducted. However, I am satisfied that the evidence currently on file does not establish that the oligonucleotide of claim 4 lacks an inventive step in light of D1 considered together with the CGK.
163. Claim 5: I have previously construed the scope of claim 5 to include a LNA+ analogue, modifications to the base and/or internucleoside linkage of a non-LNA analogue or a combination of the modifications.
164. The present specification and cross-referenced review articles do not establish that the skilled person would as a matter of course use a LNA+ analogue, or LNA in combination with a LNA+ analogue or a non-LNA analogue when designing an AON for exon skipping. It follows that the evidence currently on file does not establish that the oligonucleotide of claim 5 lacks an inventive step in light of D1 considered together with the CGK.
165. Claims 6-12: Each of claims 6-12 is directly or indirectly appended to claim 5 and therefore imports the features of claim 5. Since I have found the oligonucleotide of claim 5 does not lack an inventive step, it follows that the oligonucleotide of each of claims 6-12 also does not lack an inventive step in light of D1 considered together with the CGK.
166. However, notwithstanding my conclusion above, I note the following regarding the modifications defined in claims 6-12. In relation to modifications to the sugar moiety, I have previously discussed that the RNA article states that 2'-O-methyl and 2'-O-methoxyethyl RNA are chemical modifications which are commonly made to nucleotides of an AON. It seems reasonable to infer that a modification comprising 2'-O-methyl or 2'-O-methoxyethyl on the sugar moiety of nucleotides would be used as a matter of course by a skilled person when designing an AON at the priority date of the present application. However, the present specification and cross-referenced review articles do not establish that the skilled person would as a matter of course use LNA in combination with 2'-O-methyl, 2'-O-methoxyethyl, or any other modifications to the sugar moiety of nucleotides when designing an AON for exon skipping.
167. In relation to backbone modifications, I have previously discussed that use of 2'-O-methyl PS, morpholinos or PNAs are commonly known backbone modifications that were used as a matter of course when designing an AON for exon skipping at the priority date of the present application. However, the present specification and cross-referenced review articles do not establish that the skilled person would as a matter of course use LNA in combination with 2'-O-methyl PS, morpholinos, PNAs or any other modified backbone when designing an AON for exon skipping.
168. It may be the case that the use of LNA in combination with (1) a sugar moiety that is mono- or disubstituted at the 2', 3' and/or 5' position, or (2) 2'-O-methyl PS, morpholino, PNA, or any other backbone modification in an AON designed for exon skipping was done as a matter of course by the skilled person at the priority date of the present application. In order to establish this, further searching of the prior art may need to be conducted.
169. I am satisfied that the evidence currently on file does not establish that the oligonucleotide claimed in each of claims 6-12 lacks an inventive step in light of D1 considered together with the CGK.
170. Claim 13 is appended to any one of claims 1-12 with the additional qualification that the oligonucleotide comprises a morpholino ring, a phosphorodiamidate linkage and/or a PNA. It follows from the discussion above that the evidence currently on file does not establish that the oligonucleotide of claim 13 lacks an inventive step in light of D1 considered together with the CGK.
171. Claim 14: I have previously construed claim 14 to define a composition that is intended to be used as a medicine and comprises the oligonucleotide of claim 1-13 in combination with a pharmaceutical acceptable carrier. As previously discussed the skilled person would understand what a pharmaceutical acceptable carrier includes and the specification states information about such carriers can be found in standard pharmaceutical references. I consider that a skilled person would as a matter of course combine a pharmaceutical acceptable carrier with an oligonucleotide defined in any one of claims 1-13 at the priority date of the present application. Since I have found the oligonucleotide of claims 1-3 to lack an inventive step, it follows that combining the claimed oligonucleotide with a pharmaceutical acceptable carrier would also lack an inventive step given D1 teaches use of the disclosed AONs as treatment agents. Consequently, I conclude that claim 14 when appended to claims 1-3 lacks an inventive step in light of D1 considered together with the CGK.

172. Claim 15: Claim 15 is appended to any one of claims 1-14 with the additional qualification that the oligonucleotide or pharmaceutical composition is used in the manufacture of a medicament for treating a DMD or BMD patient. D1 states that the disclosed AONs were designed to induce exon skipping and for administration to individuals with DMD as treatment agents. Since I have found the oligonucleotide of claims 1 to 3 and the pharmaceutical composition of claim 14 to lack an inventive step, it follows that use of the claimed oligonucleotide or pharmaceutical composition in the manufacture of a medicament for treating a DMD or BMD patient would also lack an inventive step given that D1 teaches the recited use. Consequently, I conclude claim 15 when appended to claims 1-3 and 14 lacks an inventive step in light of D1 considered together with the CGK.
173. Claim 16: Claim 16 is appended to any one of claims 1-14 with the additional qualification that the oligonucleotide or pharmaceutical composition is used in an in vitro method for inducing exon 44-skipping. D1 states that the disclosed AONs were transfected into muscle cells obtained from patients by an in vitro method and exon skipping efficiency was analysed in the transfected cells. Since I have found the oligonucleotide of claims 1 to 3 and the pharmaceutical composition of claim 14 to lack an inventive step, it follows that providing a cell with the claimed oligonucleotide or pharmaceutical composition in an in vitro method for inducing skipping of exon 44 of the dystrophin pre-mRNA would also lack an inventive step given D1 teaches the recited method. Consequently, I conclude claim 16 when appended to claims 1-3 and 14 lacks an inventive step in light of D1 considered together with the CGK.
174. Claim 17: Claim 17 is appended to any one of claims 1-14 with the additional qualification that the oligonucleotide or pharmaceutical composition is used in a method for treating a DMD or BMD patient. Since I have found the oligonucleotide of claims 1 to 3 and the pharmaceutical composition of claim 14 to lack an inventive step, it follows that use of the claimed oligonucleotide or pharmaceutical composition in a method for treating a DMD or BMD patient would also lack an inventive step given that D1 teaches the recited method. Consequently, I conclude claim 17 when appended to claims 1-3 and 14 lacks an inventive step in light of D1 considered together with the CGK.
175. I conclude that each of claims 1, 2, 3 and 14-17 lacks an inventive step in light of D1 considered together with the CGK.
Conclusion on inventive step
176. I conclude that a lack of inventive step has been established for claims 1, 2, 3 and 14-17 of the present application.
177. The evidence on file does not establish that the oligonucleotide of claims 4-13 lacks an inventive step in light of D1 considered together with the CGK.
4. Other matters
178. The applicant submitted that they intend to request for an oral hearing, despite the written submissions submitted 29 January 2018, should I make any adverse finding against the present application.[130] I note that applicant did not request an oral hearing.
[130] The applicant’s written submissions dated 29 January 2018 at [69].
179. It is not open to me to conduct a further hearing having made my decision.[131] The case in R v Smith; Ex parte Mole Engineering Pty Ltd (ex parte Mole) arose in the context of an intention to hold a second hearing reconsidering all matters already decided in the original decision.[132] The High Court found that course of action was not appropriate, and explained the basis of that decision in general terms going to the finality of all matters decided in the original decision. It is clear that the High Court based its decision on a lack of jurisdiction to make a second decision, and also on a general principle of finality.
[131] R v Smith; Ex parte Mole Engineering Pty Ltd (ex parte Mole) [1981] HCA 25; 147 CLR 340.
[132] The ex parte Mole case at pages 348-349.
180. Consequently, I conclude the applicant has exercised its opportunity to be heard in the present application and the issues in this decision cannot be revisited.
5. Conclusion
181. Each of claims 1-14 of the present application is for a manner of manufacture within the meaning of s 18(1)(a) of the Act.
182. Each of claims 1, 2, 3 and 14-17 lacks an inventive step in light of D1 considered together with the CGK. The evidence on file does not establish that each of claims 4-13 lacks an inventive step.
183. It may be possible to overcome the deficiencies by amendment. According to regulation 13.4(1)(g), the present application will not lapse for failure to gain acceptance until a period of 3 months from the date of this decision.
Dr A. Lim
Delegate of the Commissioner of Patents
Annex A
Table 1A of the present application

1 (PS188) UCAGCUUCUGUUAGCCACUG SEQ ID NO 5

2 UUCAGCUUCUGUUAGCCACU SEQ ID NO 6

3 UUCAGCUUCUGUUAGCCACUG SEQ ID NO 7

4 UCAGCUUCUGUUAGCCACUGA SEQ ID NO 8

5 UUCAGCUUCUGUUAGCCACUGA SEQ ID NO 9

6 UCAGCUUCUGUUAGCCACUGA SEQ ID NO 10

7 UUCAGCUUCUGUUAGCCACUGA SEQ ID NO 11

8 UCAGCUUCUGUUAGCCACUGAU SEQ ID NO 12

9 UUCAGCUUCUGUUAGCCACUGAU SEQ ID NO 13

10 UCAGCUUCUGUUAGCCACUGAUU SEQ ID NO 14

11 UUCAGCUUCUGUUAGCCACUGAUU SEQ ID NO 15

12 UCAGCUUCUGUUAGCCACUGAUUA SEQ ID NO 16

13 UUCAGCUUCUGUUAGCCACUGAUA SEQ ID NO 17

14 UCAGCUUCUGUUAGCCACUGAUUAA SEQ ID NO 18

15 UUCAGCUUCUGUUAGCCACUGAUUAA SEQ ID NO 19

16 UCAGCUUCUGUUAGCCACUGAUUAAA SEQ ID NO 20

17 UUCAGCUUCUGUUAGCCACUGAUUAAA SEQ ID NO 21

18 CAGCUUCUGUUAGCCACUG SEQ ID NO 22

19 CAGCUUCUGUUAGCCACUGAU SEQ ID NO 23

20 AGCUUCUGUUAGCCACUGAUU SEQ ID NO 24

21 CAGCUUCUGUUAGCCACUGAUU SEQ ID NO 25

22 AGCUUCUGUUAGCCACUGAUUA SEQ ID NO 26

23 CAGCUUCUGUUAGCCACUGAUUA SEQ ID NO 27

24 AGCUUCUGUUAGCCACUGAUUAA SEQ ID NO 28

25 CAGCUUCUGUUAGCCACUGAUUAA SEQ ID NO 29

26 AGCUUCUGUUAGCCACUGAUUAAA SEQ ID NO 30

27 CAGCUUCUGUUAGCCACUGAUUAAA SEQ ID NO 31

28 AGCUUCUGUUAGCCACUGAUUAAA SEQ ID NO 32

29 AGCUUCUGUUAGCCACUGAU SEQ ID NO 33

30 GCUUCUGUUAGCCACUGAUU SEQ ID NO 34

31 AGCUUCUGUUAGCCACUGAUU SEQ ID NO 35

32 GCUUCUGUUAGCCACUGAUUA SEQ ID NO 36

33 AGCUUCUGUUAGCCACUGAUUA SEQ ID NO 37

34 GCUUCUGUUAGCCACUGAUUAA SEQ ID NO 38

35 AGCUUCUGUUAGCCACUGAUUAA SEQ ID NO 39

36 GCUUCUGUUAGCCACUGAUUAAA SEQ ID NO 40

37 AGCUUCUGUUAGCCACUGAUUAAA SEQ ID NO 41

38 GCUUCUGUUAGCCACUGAUUAAA SEQ ID NO 42

39 (PS192) CCAUUUGUAUUUAGCAUGUUCCC SEQ ID NO 43

40 (PS199) AGAUACCAUUUGUAUUUAGC SEQ ID NO 44

41 (PS187) GCCAUUUCUCAACAGAUCU SEQ ID NO 45

42 (PS194) GCCAUUUCUCAACAGAUCUGUCA SEQ ID NO 46

43 (PS191) AUUCUCAGGAAUUUGUGUCUUUC SEQ ID NO 47

44 (PS193) UCUCAGGAAUUUGUGUCUUUC SEQ ID NO 48

45 (PS200) GUUCAGCUUCUGUUAGCC SEQ ID NO 49

46 (PS201) CUGAUUAAAUAUCUUUAUAU C SEQ ID NO 50
Table 1B of the present application

47 (PS196) GCCGCCAUUUCUCAACAG SEQ ID NO 51

48 (PS197) GUAUUUAGCAUGUUCCCA SEQ ID NO 52

49 (PS198)
50 (PS189) CAGGAAUUUGUGUCUUUC
UCUGUUAGCCACUGAUUAAAU SEQ ID NO 53
SEQ ID NO 54
Annex B
Claims of the present application filed 21 November 2017.
1. An oligonucleotide, capable of inducing skipping of at least 30% of exon 44 of dystrophin pre-mRNA when tested in a muscle cell of a DMD patient using RT-PCR, having a length from about 18 to about 30 nucleotides, excluding a length of 24 nucleotides, which is an antisense oligonucleotide to SEQ ID NO. 1: (5'-GUGGCUAACAGAAGCU-3') and which comprises a nucleotide analogue being a LNA (locked nucleic acid).
2. An oligonucleotide according to claim 1, which is an 18, 19, 20, 21, 22, or 23 mer.
3. An oligonucleotide according to claim 1 or claim 2, wherein the sequence of the oligonucleotide comprises or consists of SEQ ID NO:5, 49 or 54.
4. An oligonucleotide according to any one of claims 1 to 3 comprising at least two different types of nucleotide analogues.
5. An oligonucleotide according to any one of claims 1 to 4 wherein the nucleotide analogue has a modified base and/or a non-natural internucleoside linkage or a combination of these modifications.
6. An oligonucleotide according to claim 5, wherein the oligonucleotide comprises a modified backbone.
7. An oligonucleotide according to claim 5, wherein said oligonucleotide comprises at least one nucleotide with one sugar moiety that is mono- or disubstituted at the 2', 3' and/or 5' position.
8. An oligonucleotide according to claim 5, wherein the nucleotide analogue comprises a modified base.
9. An oligonucleotide according to claim 8, wherein the modified base is a synthetic or natural base, optionally inosine, xanthine, hypoxanthine or other -aza, deaza, -hydroxy, halo, -thio, thiol, -alkyl, -alkenyl, -alkynyl, or thioalkyl derivative of pyrimidine and purine bases.
10. An oligonucleotide according to claim 5, wherein said oligonucleotide comprises at least one nucleotide with one sugar moiety that is monosubstituted at the 2', 3' and/or 5' position, optionally wherein a sugar moiety is 2'-methoxy substituted.
11. An oligonucleotide according to claim 10, wherein the oligonucleotide comprises a 2'-O-alkyl phosphorothioate oligonucleotide, optionally a 2' -O-methyl phosphorothioate oligonucleotide.
12. An oligonucleotide according to claim 6, wherein the modified backbone is selected from the group consisting of a morpholino backbone, a carbamate backbone, a siloxane backbone, a sulfide backbone, a sulfoxide backbone, a sulfone backbone, a formacetyl backbone, a thioformacetyl backbone, a methyleneformacetyl backbone, a riboacetyl backbone, an alkene containing backbone, a sulfamate backbone, a sulfonate backbone, a sulfonamide backbone,
a methyleneimino backbone, a methylenehydrazino backbone and an amide backbone.
13. An oligonucleotide according to any one of claims 1 to 12, comprising a morpholino ring, a phosphorodiamidate linkage and/or a peptide nucleic acid.
14. A pharmaceutical composition comprising an oligonucleotide according to any one of claims 1 to 13 and a pharmaceutical acceptable carrier.
15. Use of an oligonucleotide according to any one of claims 1 to 13 or a pharmaceutical composition according to claim 14 in the manufacture of a medicament for treating a DMD or BMD patient.
16. An in vitro method for inducing skipping of exon 44 of the dystrophin pre-mRNA in a cell, the method comprising providing said cell with an oligonucleotide according to any one of claims 1 to 13 or a pharmaceutical composition according to claim 14.
17. A method of treating a DMD or BMD patient comprising administering to the patient an oligonucleotide according to any one of claims 1 to 13 or a pharmaceutical composition according to claim 14.

1 (PS188)	UCAGCUUCUGUUAGCCACUG	SEQ ID NO 5
2	UUCAGCUUCUGUUAGCCACU	SEQ ID NO 6
3	UUCAGCUUCUGUUAGCCACUG	SEQ ID NO 7
4	UCAGCUUCUGUUAGCCACUGA	SEQ ID NO 8
5	UUCAGCUUCUGUUAGCCACUGA	SEQ ID NO 9
6	UCAGCUUCUGUUAGCCACUGA	SEQ ID NO 10
7	UUCAGCUUCUGUUAGCCACUGA	SEQ ID NO 11
8	UCAGCUUCUGUUAGCCACUGAU	SEQ ID NO 12
9	UUCAGCUUCUGUUAGCCACUGAU	SEQ ID NO 13
10	UCAGCUUCUGUUAGCCACUGAUU	SEQ ID NO 14
11	UUCAGCUUCUGUUAGCCACUGAUU	SEQ ID NO 15
12	UCAGCUUCUGUUAGCCACUGAUUA	SEQ ID NO 16
13	UUCAGCUUCUGUUAGCCACUGAUA	SEQ ID NO 17
14	UCAGCUUCUGUUAGCCACUGAUUAA	SEQ ID NO 18
15	UUCAGCUUCUGUUAGCCACUGAUUAA	SEQ ID NO 19
16	UCAGCUUCUGUUAGCCACUGAUUAAA	SEQ ID NO 20
17	UUCAGCUUCUGUUAGCCACUGAUUAAA	SEQ ID NO 21
18	CAGCUUCUGUUAGCCACUG	SEQ ID NO 22
19	CAGCUUCUGUUAGCCACUGAU	SEQ ID NO 23
20	AGCUUCUGUUAGCCACUGAUU	SEQ ID NO 24
21	CAGCUUCUGUUAGCCACUGAUU	SEQ ID NO 25
22	AGCUUCUGUUAGCCACUGAUUA	SEQ ID NO 26
23	CAGCUUCUGUUAGCCACUGAUUA	SEQ ID NO 27
24	AGCUUCUGUUAGCCACUGAUUAA	SEQ ID NO 28
25	CAGCUUCUGUUAGCCACUGAUUAA	SEQ ID NO 29
26	AGCUUCUGUUAGCCACUGAUUAAA	SEQ ID NO 30
27	CAGCUUCUGUUAGCCACUGAUUAAA	SEQ ID NO 31
28	AGCUUCUGUUAGCCACUGAUUAAA	SEQ ID NO 32
29	AGCUUCUGUUAGCCACUGAU	SEQ ID NO 33
30	GCUUCUGUUAGCCACUGAUU	SEQ ID NO 34
31	AGCUUCUGUUAGCCACUGAUU	SEQ ID NO 35
32	GCUUCUGUUAGCCACUGAUUA	SEQ ID NO 36
33	AGCUUCUGUUAGCCACUGAUUA	SEQ ID NO 37
34	GCUUCUGUUAGCCACUGAUUAA	SEQ ID NO 38
35	AGCUUCUGUUAGCCACUGAUUAA	SEQ ID NO 39
36	GCUUCUGUUAGCCACUGAUUAAA	SEQ ID NO 40
37	AGCUUCUGUUAGCCACUGAUUAAA	SEQ ID NO 41
38	GCUUCUGUUAGCCACUGAUUAAA	SEQ ID NO 42
39 (PS192)	CCAUUUGUAUUUAGCAUGUUCCC	SEQ ID NO 43
40 (PS199)	AGAUACCAUUUGUAUUUAGC	SEQ ID NO 44
41 (PS187)	GCCAUUUCUCAACAGAUCU	SEQ ID NO 45
42 (PS194)	GCCAUUUCUCAACAGAUCUGUCA	SEQ ID NO 46
43 (PS191)	AUUCUCAGGAAUUUGUGUCUUUC	SEQ ID NO 47
44 (PS193)	UCUCAGGAAUUUGUGUCUUUC	SEQ ID NO 48
45 (PS200)	GUUCAGCUUCUGUUAGCC	SEQ ID NO 49
46 (PS201)	CUGAUUAAAUAUCUUUAUAU C	SEQ ID NO 50

47 (PS196)	GCCGCCAUUUCUCAACAG	SEQ ID NO 51
48 (PS197)	GUAUUUAGCAUGUUCCCA	SEQ ID NO 52
49 (PS198) 50 (PS189)	CAGGAAUUUGUGUCUUUC UCUGUUAGCCACUGAUUAAAU	SEQ ID NO 53 SEQ ID NO 54