Pioneer Hi-Bred International, Inc. v Dow AgroSciences LLC

[2014] APO 62

IP AUSTRALIA

AUSTRALIAN PATENT OFFICE

Pioneer Hi-Bred International, Inc. v Dow AgroSciences LLC [2014] APO 62

Patent Application:                   2004210965

Title:Altered FAD2 and FAD3 genes in brassica and the molecular marker-assisted detection thereof

Patent Applicant:  Dow AgroSciences LLC

Opponent:  Pioneer Hi-Bred International, Inc.

Delegate:  Dr B. Akhurst

Decision Date:  29 August 2014

Hearing Date:  14 July 2014 in Canberra

Catchwords:  PATENTS – section 104 opposition – obvious mistake established – insufficient evidence to establish a clerical error.

Representation:  Patent applicant: Dr Mark Wickham and David Longmuir, patent attorneys of Phillips Ormonde Fitzpatrick. 

Opponent: Dr Nigel Parker and Dr Victoria Longshaw, patent attorneys of Houlihan².  

IP AUSTRALIA

AUSTRALIAN PATENT OFFICE

Patent Application:                   2004210965

Title:Altered FAD2 and FAD3 genes in brassica and the molecular marker-assisted detection thereof

Patent Applicant:  Dow AgroSciences LLC

Date of Decision:  29 August 2014

DECISION

The opposition fails.

I allow the amendments proposed on 11 May 2013 and 2 August 2012.

I award costs according to Schedule 8 against Pioneer Hi-Bred International, Inc.

REASONS FOR DECISION

Background

1. Patent application 2004210965 (’965) was filed by Dow AgroSciences LLC (Dow) on 11 February 2004 under the provisions of the PCT, claiming priority from basic application US 60/446,429 filed on 11 February 2003.  The application was examined by the Commissioner and advertised as accepted on 13 May 2010. 

2. A notice of opposition to grant of a patent was served by Pioneer Hi-Bred International, Inc. (Pioneer) on 13 August 2010, followed by a statement of grounds and particulars (SGP) on 15 November 2010.  A request by Pioneer on 11 November 2011 for leave to amend the SGP was allowed on 7 December 2011.  Evidence in support was served on 13 November 2011. 

3. On 11 May 2012, Dow filed two requests under section 104 for leave to amend the specification.  After the examiner reported inconsistencies in the specification, on 2 August 2012 Dow filed a further amendment request.  The grant of leave to amend was advertised under regulation 10.5(2) on 8 November 2012. 

4. On 8 February 2013, Pioneer filed a notice of opposition to the amendments under section 104(4) and a SGP on 12 April 2013.  Evidence in support of this opposition was completed on 12 September 2013.  Evidence in answer was completed on 12 December 2013.  After notifying its intention to file evidence in reply, on 12 March 2014 Pioneer advised it would not do so. 

5. The hearing was set for 14 July 2014 in Canberra.  Pioneer filed a summary of submissions on 3 July 2014.  Dow filed its summary on 7 July 2014.

   The evidence

6. Evidence in support consisted of declarations by:

   ·    Prof. David Edwards (DE) dated 11 September 2013 with exhibit DE-1

   ·    Dr. Dieter Mark Bulach (DMB) dated 11 September 2013with exhibit DMB-1

7. Evidence in answer consisted of declarations by:

   ·    Dr. R. Keith Downey (RKD) dated 10 December 2013 with exhibits RKD-1 and RKD-2

   ·    Marcia I. Rosenfeld (MIR) dated 11 December 2013 with exhibits MIR-1 and MIR-2

   The specification

8. At paragraph [0001] of the ’965 specification, the invention relates to methods for marker-assisted selection for high oleic acid and low linolenic acid traits in Brassica species (including canola and other oil seed crop species), in addition to isolated nucleic acids for use as molecular markers in such methods. 

9. A nucleic acid (or DNA) marker is a nucleic acid sequence that can unambiguously identify the presence of a DNA sequence in a sample of interest, using molecular biology techniques (description at para [0034], DE at [15], DMB at [11]).  For example, the marker may be used as a primer in a polymerase chain reaction (PCR) assay to amplify a corresponding sequence in a sample, thus providing an indication of the genotype of the organism from which the sample is derived (description at [0051]; DE at [18], DMB at [11]).

10. At [0004], the description states that the quality of oils derived from canola seed is determined by its constituent fatty acids. Oils exhibiting increased monounsaturated oleic acid and reduced polyunsaturated linoleic and linolenic fatty acids have improved properties in terms of oxidative stability, flavour and storage life (paras [0004]-[0005]). Selective breeding for high oleic acid and low linolenic acid traits based on phenotypic selection of plants is unreliable ([0007]-[0008], [0011]-[0014]). At [0016], the description states it would be advantageous to develop high throughput PCR markers linked to high oleic acid and low linolenic acid content in order to facilitate the selection of these traits in oil seed crop trait introgression and breeding.

11. To this end, the application describes studies undertaken in two canola varieties, DMS100 and Quantum.  DMS100 is a hybrid canola which exhibits high (77%) oleic acid and low (3%) linolenic acid content, while Quantum is a wildtype commercial variety containing approximately 66% oleic acid and 7% linolenic acid content ([0043]).  

12. Relevant to this opposition, fragments were cloned from the Quantum and DMS100 fad2 gene sequences which encode a fatty acid desaturase enzyme involved in fatty acid synthesis ([0043]).  DMS100 fad2 was found to contain a sequence mutation when compared with the Quantum sequence ([0043]-[0044]). Further analysis confirmed that this single nucleotide polymorphism (SNP) in DMS100 resulted in a truncated inactive fad2 protein accounting for the increased oleic acid content in this canola variety ([0043]-[0044], [0047]). Knowledge of this mutation permits direct selection of high oleic acid Brassica varieties on the basis of the fad 2 mutant-specific genotype ([0021]-[0021]).

13. The specification as filed and as amended refers to a fad2 mutant-specific primer sequence in paragraphs [0051] and [0052] which is designated SEQ ID NO: 5.  Figure 1 presents the aligned nucleic acid sequences of the cloned fad2 gene fragments from DMS100 (SEQ ID NO: 7) and Quantum (SEQ ID NO: 9), with forward and reverse primers indicated in the DMS100 sequence. 

    The opposition

14. In combination, Dow’s statements of proposed amendments contain item numbers 1-5.  At the hearing, Pioneer’s opposition was confined to item numbers 1 and 4.  If allowed, these amendments would remove a guanine-containing nucleotide (G) from the nucleic acid sequence identified as SEQ ID NO: 5 in paragraphs [0051] and [0052] of the description.  Specifically, that nucleic acid sequence would be altered from CGCACCGTGATGGTTAACGGTTT to CGCACCGTGATGTTAACGGTTT.

15. Since paragraphs [0051] and [0052] provide the only explicit reference to SEQ ID NO: 5 and its nucleotide sequence, the effect of the sequence amendments would be to alter the monopoly encompassed by claims that refer to SEQ ID NO: 5.  At the hearing, this was discussed primarily in the context of claim 1 which is as follows:

    An isolated and purified genetic marker associated with high oleic oil content in Brassica, said marker mapping to a linkage group selected from the group consisting of N5 and N1 in the Brassica genome, said marker having a sequence from SEQ. ID. NO. 5 or a derivative thereof.

16. Pioneer contended that the amendment to the nucleic acid sequence of SEQ ID NO: 5 does not satisfy the allowability criteria set out in subsections 102(1), 102(2)(a) or 102(2)(b), nor the requirements of a “clerical error” or “obvious mistake” for the purposes of subsection 102(3).  

    Relevant Law

17. The request for examination of the patent application was filed on 5 April 2007.  As a consequence, substantive amendments of the Patents Act 1990 brought about by the Intellectual Property Laws Amendment (Raising the Bar) Act 2012 do not apply to the present application.  This includes an amendment to subsection 102(1), which precludes the inclusion of subject matter extending beyond the original disclosure. 

18. The sections of the Patents Act relevant to the allowability of amendments in this opposition are in section 102 as it existed prior to the introduction of the Raising the Bar Act, which are as follows:

    “(1) An amendment of a complete specification is not allowable if, as a result of the amendment, the specification would claim matter not in substance disclosed in the specification as filed.

    (2)   An amendment of a complete specification is not allowable after the relevant time if, as a result of the amendment:

    (a) a claim of the specification would not in substance fall within the scope of the claims of the specification before amendment; or

    (b) the specification would not comply with subsection 40(2) or (3).

    (2A) For the purposes of subsection (2), relevant time means:

    (a)in relation to an amendment proposed to a complete specification relating to a standard patent - after the specification has been accepted; …

    …

    (3)  This section does not apply to an amendment for the purpose of correcting a clerical error or an obvious mistake made in, or in relation to, a complete specification.”

19. Since subsections 102(1) and 102(2) do not apply if an amendment is for a purpose set out in subsection 102(3), it is appropriate to consider first whether the opposed amendment corrects a clerical error or an obvious mistake made in, or in relation to, the complete specification. 

20. The onus to establish that the error is a clerical error or obvious mistake lies with the applicant (Expo-Net Danmark A/S v Buono-Net Australia Pty Ltd [2010] FCA 983 at [13]). There was no dispute that the standard of proof that applies to this ground is the balance of probabilities.

    Obvious mistake

21. To be considered an obvious mistake for the purposes of section 102(3), the mistake must be obvious and the proper correction must also be obvious:

    “an obvious mistake … involves that the instructed public can, from an examination of the specification, appreciate the existence of the mistake and the proper answer by way of correction”

    (General Tire & Rubber Company (Frost’s) Patent [1972] RPC 259 at 279 applied by Bennett J in Expo-Net Danmark A/S v Buono-Net Australia Pty Ltd [2010] FCA 983 at [13]; (2010) IPR 1 at [13]).

    Obvious mistake?

22. To be an obvious mistake, the mistake must be evident from the specification.  Pioneer submitted that the mistake was not obvious since none of the experts identified the discrepancy between the nucleotide sequence of SEQ ID NO: 5 and the forward primer sequence in Fig 1 without being directed to it.  Dow disputed this, arguing that an additional G in the mutant-specific primer identified as SEQ ID NO: 5 is inconsistent with the focus of the invention described and claimed in the specification.  Relying on Dr Downey’s evidence it argued that the mistake would be apparent when a party sought to work the invention to detect the fad2 mutation.

23. I note that Dr Downey’s instructions included the information that the nucleotide sequence of the FAD2GM primer identified as SEQ ID NO: 5 in paragraphs [0051] and [0052] of the specification was incorrect in that it contained an additional G (RKD at [11]-[12]).  It is not clear whether the opponent’s declarants were made aware of the existence and nature of the error prior to giving evidence, or whether they noticed it themselves.  In any event, all of the experts acknowledged that the specification contained an error in that the nucleotide sequence of SEQ ID NO: 5, described in paragraphs [0051] and [0052] as the mutant-specific primer FAD2GM, is different from that of the forward primer identified in the DMS100 fad2 gene sequence in Figure 1 (DE at [21]-[22]; DMB at [14]; RKD at [12]). 

24. Pioneer’s experts understood that the nucleotide sequences of SEQ ID NO: 5 and the forward primer in Fig 1 should be the same (DE at [20]-[22]; DMB at [14]).  Dr Downey’s evidence is consistent with this (RKD at [15] 1st sentence).  I consider such a conclusion reasonable in the circumstances, since it is consistent with the statement in paragraphs [0051] and [0052] of the specification describing the fad2 mutant-specific primer FAD2GM in terms of the nucleotide sequence designated SEQ ID NO: 5 and by reference to Figure 1. 

25. I am satisfied that on examination of the ’965 specification, the instructed public could appreciate the existence of an error.

    Obvious correction?

26. Regarding whether the correction would be obvious, Pioneer submitted the nucleotide sequence of SEQ ID NO: 5 appears twice in the ’965 specification as filed and in both instances it contains the additional G.  Pioneer noted that if Dow seeks to rely on the forward primer in Figure 1 as support for the obvious correction, there is no evidence that establishes that this shorter sequence is actually correct.  In particular, Pioneer noted that there is no sequence data per se, such as a sequence trace or a sequence listing, and no material deposited under the Budapest Treaty upon which Dow could rely to provide a full description of the DMS100 fad2 sequence.

27. Pioneer’s experts confirm that in order to unequivocally or with any degree of certainty determine which nucleotide sequence is correct, it would be necessary to consult original sequence data or to re-sequence that region of the DMS100 fad2 gene (DE at [22], [25]; DMB at [17]).  Dr Downey would also take this approach in the first instance (RKD at [13]). 

28. However, Dow noted that Pioneer’s experts provide no evidence regarding how they would have tried to correct the mistake and determine the correct sequence, based on the information in the specification.  Dow submitted that it is clear from Dr Downey’s evidence that, given the focus of the invention described and claimed in the specification, the proposed amendment to remove a G from both occurrences of SEQ ID NO: 5 would have been recognised as the obvious, proper correction.  

29. Dr Downey considers the additional G in both occurrences of SEQ ID NO: 5 to be inconsistent with the invention described in the specification for a number of reasons.  Firstly, the specification describes the mutation in the DSM100 fad2 gene, relative to that of Quantum, as a single nucleotide mutation C to T at position 411 of SEQ ID NO: 7 that creates a stop codon (TAG) ([0023]-[0024], [0044], Figure 1; RKD at [17], [23]).  Dr Downey considers that the reference to a single mutation is inconsistent with there being a second mutation such as an additional G in SEQ ID NO: 5, which is not discussed further in the specification (RKD [23]-[24]).   

30. Secondly, the specification states that as a result of the C to T mutation and its stop codon, the DMS100 fad2 gene translates into a truncated polypeptide sequence containing only 185 amino acids instead of the 384 present in the full length Quantum protein ([0044] referring to Figure 2; RKD at [27]).  The evidence establishes that if SEQ ID NO: 5 with the additional G is correct, the reading frame of the fad2 gene sequence would be altered relative to the fad2 mutation described in the specification (RKD at [16]; DMB at [16]).  However, while the additional G would result in a truncated polypeptide (DE at [23]; DMB at [15]), it would be longer than the 185 amino acids indicated in the specification (DE at [23]; RKD at [31]). 

31. Thirdly, at [0048] the specification states that using a PCR primer pair derived from Arabidopsis fad2, the DNA fragments amplified and cloned from the DMS100 and Quantum fad2 genes are both the same length.  Although that length is said to be 986 base pairs, it appears from Figure 1 and the Arabidopsis primer sequences in paragraph [0048] (SEQ ID NOs: 1 and 2), that the amplified DMS100 and Quantum fad2 fragments are both 985 base pairs long.  In any event, paragraph [0048] and Figure 1 of the specification are consistent insofar as they describe the fragments cloned from DMS100 and Quantum as being the same length.  Dr Downey points out that if the additional G in SEQ ID NO: 5 was correct, the PCR product from DMS100 fad2 would be longer by 1 base pair (RKD at [30]). 

32. Given these inconsistencies between the disclosure in the specification of the nature and effect of the DMS100 fad2 mutation, in comparison to the predicted effect of an additional G in SEQ ID NO: 5, Dr Downey concludes that it is clear from reading the specification that the nucleotide sequence of SEQ ID NO: 5 is in error and that the sequence set out in SEQ ID NO: 7 in Figure 1 provides the proper correction (RKD at [28], [30], [32]-[33]).    

33. Notwithstanding that he was made aware of the error and the proper correction before giving evidence, I consider Dr Downey’s reasoning in this regard to be logical and probative.  Pioneer has served no evidence in reply to Dr Downey’s statements.  While Pioneer’s experts state that it is not possible to unequivocally determine, or determine with any degree of certainty, the correct sequence (DE at [25]; DMB at [17]), this is a higher standard of proof than is required for this ground of opposition.  

34. I am satisfied that having examined the specification, the instructed public would appreciate that it is more likely than not that the forward primer sequence in Figure 1 provides the proper answer to correct the inconsistency between the nucleotide sequence identified as SEQ ID NO: 5 in paras [0051] and [0052] of the specification, and that set out in SEQ ID NO: 7 in Figure 1. 

35. I find that amendment item numbers 1 and 4 correct an obvious mistake in the ’965 specification.

    Clerical error

36. The High Court found that the characteristic of a clerical error is not that it is in itself trivial or unimportant, but that it arises in the mechanical process of writing or transcribing (R v Commissioner of Patents; Ex parte Martin [1953] HCA 67 (R v Commissioner) (1953) 89 CLR 381 at 406 (Fullagar J at [10], Kitto and Taylor JJ agreeing). Consistent with this, Williams ACJ expressed the view that:

    “A clerical error, I would think, occurs where a person either of his own volition or under the instructions of another intends to write something and by inadvertence either omits to write it or writes something different.” (89 CLR at 396)

37. In its amendment request of 11 May 2012, Dow described the amendment to SEQ ID NO: 5 as correcting a clerical error.  At the hearing, Dow submitted that a typographical error occurred when preparing the text for provisional patent application US 60/446,429 from information in a Dow AgroSciences internal report (the internal report) which describes the research and primary data including the correct sequence of the fad2 mutant-specific primer FAD2GM.  Dow submitted that the error in the priority document was then carried over into paragraphs [0051] and [0052] of the ’965 complete specification.

38. I accept that an error in preparing the priority document would be an error made “in relation to” the complete specification.  The question is whether Dow has discharged the onus of establishing that the error in the priority document was the result of a clerical error.

39. Dow’s evidence regarding a clerical error is provided in a declaration by its Patent Counsel Marcia Rosenfeld and two accompanying exhibits.  Exhibit MIR-1 consists of four pages extracted from the original 69-page internal report.  These are the cover page containing bibliographic information and a brief summary; page 14 which provides the correct nucleotide sequence of the FAD2GM forward primer; and pages 35-36 which provide the partial fad2 gene sequences cloned from DMS100 and Quantum as they appear in Figure 1 of the opposed specification.  MIR-2 exhibits the specification of provisional application US 60/446,429.

40. Overall, Ms Rosenfeld’s evidence establishes that an additional G appears in the FAD2GM nucleotide sequence of SEQ ID NO: 5 in paras [0051] and [0052] of the ’965 specification and the corresponding text in the priority document, whereas the pages in evidence from Dow’s internal report present the fad2 mutant-specific primer sequence without the additional G, consistent with Figure 1 of the ’965 specification (MIR at paras [4]-[10], [14]-[15], [18]-[20]). 

1. Regarding a clerical error, under the heading ‘My instructions’ Ms Rosenfeld states:

   “3.   To the best of my knowledge, the error in SEQ ID NO: 5 referred to in the specification of the Opposed Application is a typographical one.  POF [Phillips, Ormonde Fitzpatrick] have asked me to outline how the typographical error occurred and I set this out below.

2. Under the heading ‘The error’ Ms Rosenfeld compares the information in paragraphs [0051] and [0052] and Figure 1 of the ’965 specification as filed and concludes there is an additional G in the mutant-specific primer in paragraphs [0051] and [0052] (MIR at [4]-[10]). 

3. Under ‘The report’, Ms Rosenfeld states:

   “11. Now produced to me and marked Exhibit MIR-1 is a copy of pages 1, 14, 35 and 36 of a Dow AgroSciences Internal Report titled “Molecular Mapping and Cloning of Genes Controlling Oleic and Linolenic Acid Content in Canola (Brassica napus L.)” dated 31 December 2002 (“the Report”).

   12.  These pages of the Report set out the relevant data used in the preparation of the relevant text of the specification of the Opposed Application.

   …

   16.The Report was used in the preparation of United States Patent Application 60/446,429 from which the Opposed Application claims priority.”

4. After comparing the nucleotide sequences of the mutant-specific primer FAD2GM in the text and Figures of the ’965 specification, its priority document and page 14 of the internal report (paragraphs [13]-[19]), Ms Rosenfeld continues:  

   “20. The sequence of the FAD2GM primer (SEQ ID NO: 5) recited at paragraph [0053] [of the priority document] includes an additional “G” at position 12 or 13 of the sequence relative to the sequence recited in Figure 1 of US 60/446,429, and relative to the sequence recited in the Report (e.g. at page 14 and Figure 10 of the Report) used to prepare US 60/446,429.

   21.  The Report was only available as a Portable Digital Format (PDF) document, and it appears a typographical error was made when the sequence of the FAD2GM primer (SEQ ID NO: 5) was re-typed in the preparation of the text of US 60/446,429.  The typographical error occurred when transcribing the sequence of the FAD2GM primer (SEQ ID NO: 5) from the Report to the text used for paragraph [0053] of US 60/446,429, and this error is the addition of an additional “G” at position 12 or 13 of the sequence of the FAD2GM primer (SEQ ID NO: 5).  …

   22.  The typographical error made in [0053] of US 60/446,429 was carried over into the text used for the Opposed Application, which as a result (and before amendment) referred to the incorrect sequence at paragraphs [0051] and [0052] of the Opposed Application, but not in Figure 1 of the Opposed application. 

   23.  I was notified by POF of the typographical error in the description of the Opposed Application following review of the Opponent’s Evidence in Support … .  This raised the possibility of a typographical error in one of the sequences referred to.

   24.  After being made aware of the possibility of a typographical error on page 22 of the Opposed Application, the Applicant instructed POF to prepare and file amendments to correct the typographical error in SEQ ID NO: 5 …

   …

5. Ms Rosenfeld completes her declaration with the statement:

   25.  It was always the intention of the attorney preparing the text of US 60/446,429 that the correct sequence of the FAD2GM primer be transcribed into the text of US 60/446,429, however an additional “G” at position 12 or 13 of the sequence of the FAD2GM primer was inadvertently included when the sequence was typed.”

6. Pioneer submitted that Ms Rosenfeld’s conclusion that a typographical error occurred is an assumption.  It argued that there is no direct evidence of a clerical error being made and the evidence provided is insufficient to establish that a clerical error occurred.  I am inclined to agree.

7. Firstly, there is an element of inconsistency in Ms Rosenfeld’s evidence in that she appears, at [12] and [16], to say that the data in the internal report was used to prepare the text of both the priority document and the ’965 specification and then at [22] that the information in the priority document was used to prepare the ’965 specification. 

8. In any event, there is nothing in evidence to establish that pages 14 and Figure 10 of the internal document provides the only reference to the fad2 mutant-specific primer and that any and all other occurrences of the primer nucleotide sequence in that document were correct.  If an additional reference to the sequence contained the additional G then accurately transcribing the erroneous sequence into the priority document and/or the ’965 specification could not be considered a clerical error made in relation to the complete specification.

9. Furthermore, while Ms Rosenfeld refers to the attorney preparing the text of the priority document, she provides no basis for her conclusions regarding the attorney’s intentions and subsequent errors.  It is not clear from her evidence that she made any enquiries to try to ascertain the events that took place at the time the priority document was drafted.  It is not clear who the drafting attorney was and why he or she was unable to provide evidence in this regard.  Nor has any indirect evidence been provided from Dow’s records, for example, its drafting instructions may have been helpful in establishing the sequence of events submitted by Dow.  However, nothing of this nature has been provided.  

10. Since it is not apparent from Ms Rosenfeld’s evidence that she was in a position to know the circumstances surrounding the preparation of the priority document and the ’965 complete specification, her qualified statements at [3] that “to the best of [her] knowledge the error …  is a typographical one” and at [21] that “it appears a typographical error was made” are understandable in the circumstances.  However, these statements appear to reflect a tentative conclusion drawn by Ms Rosenfeld from the little information before her, rather than direct evidence that a relevant clerical error did, in fact, occur. 

11. Dow has not established a clerical error for the purposes of section 102(3).

    CONCLUSION

12. I have found above that the amendments proposed under item numbers 1 and 4 on 11 May 2012 and 2 August 2012, respectively, correct an obvious mistake in the specification.  Therefore, pursuant to subsection 102(3), the criteria governing the allowability of amendments set out in subsections 102(1) and 102(2) do not apply to these amendments. 

13. Leave was granted by the examiner for the amendment filed as item numbers 2, 3 and 5 and these have not been opposed. 

14. I allow all of the amendments filed on 11 May 2012 and 2 August 2012.

    COSTS

15. It is usual in matters before the Commissioner for costs to follow the event.  Pioneer has been unsuccessful in this opposition. 

16. Pioneer filed its summary of submissions for the hearing late.  Dow’s were on time.

17. In these circumstances, I see no reason to vary the usual practice, I therefore award costs according to Schedule 8 against Pioneer Hi-Bred International, Inc.

    Dr B. Akhurst
    Delegate of the Commissioner of Patents